ID: 1123716694

View in Genome Browser
Species Human (GRCh38)
Location 15:23039137-23039159
Sequence GCGTGAACTGGGTTTCTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716694_1123716701 7 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716701 15:23039167-23039189 GTGACGATCAGGACGCGTCCCGG 0: 1
1: 0
2: 0
3: 0
4: 20
1123716694_1123716702 8 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20
1123716694_1123716703 23 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716694_1123716697 -4 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716697 15:23039156-23039178 ACGCTTTCCCCGTGACGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716694 Original CRISPR GCGTGAACTGGGTTTCTTGC CGG (reversed) Intronic
905335817 1:37243891-37243913 CAGTGACCTGGGTGTCTTGCCGG - Intergenic
907023552 1:51093221-51093243 AGGTGAGGTGGGTTTCTTGCAGG - Intergenic
907605132 1:55808493-55808515 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
907869798 1:58432831-58432853 ACATGAACTGGGCTTCTTTCAGG + Intronic
909720651 1:78765631-78765653 AGGTGAAGTGGGTTTCTTGTAGG + Intergenic
911811462 1:102287301-102287323 TGGTGAAGTGTGTTTCTTGCAGG - Intergenic
911968028 1:104392418-104392440 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
912589851 1:110806216-110806238 AAGTGAAGTGGGTTTCTTACAGG - Intergenic
915625541 1:157112000-157112022 GAGTGAAATGGGTTTATTACTGG - Intergenic
917425419 1:174907912-174907934 AGGTGAAATGGGTTTCTTGAAGG - Intronic
917906744 1:179592345-179592367 GCGTTAACTGGGGTTCCTGTCGG - Intronic
918025681 1:180743017-180743039 GTTTGAAGTGAGTTTCTTGCAGG + Intronic
918959419 1:191253712-191253734 GGGTGAAGTGAGTTTCTTGTAGG + Intergenic
919594119 1:199540281-199540303 GTGTGAGATGGGTTTCTTGAAGG - Intergenic
921941987 1:220851457-220851479 AGGTGAAGTGGGTTTCCTGCAGG + Intergenic
921994256 1:221399808-221399830 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
922141922 1:222895733-222895755 GGGTTAACTGGATCTCTTGCAGG + Intronic
1064188763 10:13187098-13187120 GTGGGTACTGGGTTTCTTTCTGG - Intronic
1068820998 10:61377219-61377241 GCGGGAACTGGGCTGCATGCGGG - Intergenic
1069829700 10:71275288-71275310 GCCGGATCTGGGTTTCCTGCTGG - Intronic
1070215414 10:74374158-74374180 GAGTGAACTGGTTTTTTTGGGGG + Intronic
1070584982 10:77757567-77757589 AGGTGAAATGGGTTTCTTGAAGG - Intergenic
1072399050 10:95078368-95078390 AGGTGAAGTGTGTTTCTTGCAGG + Intergenic
1074114958 10:110449266-110449288 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
1074408736 10:113204357-113204379 GTGTGAAGTGTGTTTCTTGTAGG - Intergenic
1078903532 11:15663502-15663524 GAGTGTGCTGGGTTTCCTGCGGG - Intergenic
1079565922 11:21882281-21882303 GGATGAAGTGGGTTTCTTGTGGG - Intergenic
1080351379 11:31389252-31389274 AGGTGAAGTGGGTTTCTTGTAGG - Intronic
1085577056 11:77615064-77615086 GAGTGTACTTGGTTTCTTGTTGG - Exonic
1087476721 11:98645103-98645125 ATGTGAACTGGTTTTCTGGCTGG - Intergenic
1087870915 11:103291949-103291971 ATGTGAACTGAGTTTCTTGTAGG + Intronic
1088332988 11:108672232-108672254 GCCTGTACTGTGTCTCTTGCTGG + Intronic
1093123795 12:15304428-15304450 AGGTGAAGTGTGTTTCTTGCAGG + Intronic
1095776331 12:46013965-46013987 AGGTGAAGTGGGTTTCTTGCAGG + Intergenic
1097196480 12:57244877-57244899 GAGAGAACTGGGTTCCTTGCAGG + Intronic
1097425812 12:59443330-59443352 GGGTGAATTGTGTTTCTTGCAGG + Intergenic
1098142639 12:67466571-67466593 GGGTGAAGTGTGTTTCTTGTAGG + Intergenic
1098491790 12:71090525-71090547 AGGTGAAGTGTGTTTCTTGCAGG + Intronic
1098555776 12:71817411-71817433 GTGTGTTCTGGGTTTCTTGAAGG - Intergenic
1099074726 12:78092447-78092469 GGGTGAAATGAGTTTCTTTCTGG - Intronic
1099435451 12:82637212-82637234 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
1101393103 12:104321161-104321183 GAGTGCGCTGGATTTCTTGCTGG + Exonic
1101792734 12:107943474-107943496 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
1103979426 12:124726875-124726897 GCATGCACTGGGTTTCTTCCGGG - Intergenic
1104061060 12:125269027-125269049 TAGTTAATTGGGTTTCTTGCAGG + Intronic
1105274796 13:18910218-18910240 AGGTGAACTGAGTTTCTTGTAGG + Intergenic
1107551911 13:41484700-41484722 ATGTGAAGTGTGTTTCTTGCAGG + Intergenic
1108157953 13:47606472-47606494 CAGTGAATTGGGTTTCTTGAAGG - Intergenic
1109214612 13:59574485-59574507 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
1112546637 13:100377415-100377437 GGGTGAAGTGTGTTTCTTGCAGG + Intronic
1115839867 14:37457881-37457903 CCATGAGGTGGGTTTCTTGCAGG - Intronic
1116027376 14:39531571-39531593 AGGTGAAGTGGGTTTCTTGAAGG + Intergenic
1116265623 14:42686307-42686329 GAGGGCACTGGGTTTCATGCAGG + Intergenic
1120426579 14:84355422-84355444 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
1120917532 14:89722957-89722979 GCCTGAAGTGGCTGTCTTGCTGG + Intergenic
1121153203 14:91656755-91656777 AGGTGAAGTGTGTTTCTTGCAGG - Intronic
1122133645 14:99620393-99620415 CCCTGACCTGGGCTTCTTGCAGG + Intergenic
1122500329 14:102193812-102193834 GCGTGAACTGGGTGTCTTGAGGG + Intronic
1123716694 15:23039137-23039159 GCGTGAACTGGGTTTCTTGCCGG - Intronic
1126716998 15:51528320-51528342 GTGTGAAGTGTGTTTTTTGCAGG - Intronic
1126751344 15:51880454-51880476 ACGTGCACAGGGTTTCTTTCTGG - Intronic
1127324049 15:57877101-57877123 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
1127855484 15:62950296-62950318 GAGTCAGCTGGGTTCCTTGCAGG + Intergenic
1128475814 15:67996040-67996062 GCATGGACTGGGTGTCTGGCAGG + Intergenic
1134321669 16:13169834-13169856 GGTTGCACTGGGTTTCTGGCTGG + Intronic
1138066155 16:53943382-53943404 GCATGAACTCTGTTTCTGGCAGG + Intronic
1144137562 17:12312867-12312889 GTGTGAGCTGGGTCTCTTGAAGG + Intergenic
1149111027 17:53030837-53030859 GGGTGAAGTGTGTTTCTTGTAGG + Intergenic
1151970434 17:77454831-77454853 GCCTGAGCTGGGTTCCCTGCTGG + Intronic
1153024219 18:658446-658468 GCGGGAACTTGGTTTCCTGGTGG + Intronic
1154061697 18:11067485-11067507 ATGTGAAGTGAGTTTCTTGCAGG - Intronic
1158439219 18:57459177-57459199 GGGTGAAGTGGGTTTCCTGAAGG - Intronic
1158474690 18:57769477-57769499 CCTTGCACTGAGTTTCTTGCTGG - Intronic
1160805741 19:991585-991607 GCGTGAACTGGGTTTGCTGTGGG + Intronic
1160805807 19:991754-991776 GCGTGAACTGGCTTTGCTGTGGG + Intronic
1163349255 19:16765037-16765059 GCATGAGCTGGATTTCCTGCCGG + Exonic
1165402820 19:35612815-35612837 GCGGGAACTGGGTTGCTGGGCGG + Exonic
1166408014 19:42536694-42536716 GGTTGAAATGTGTTTCTTGCAGG + Intronic
1166622996 19:44320944-44320966 AGGTGAAGTGGGTTTCTTGCAGG + Intergenic
1168366825 19:55795375-55795397 ACGTGAACTGGGTGTCGTGTAGG - Intronic
925269671 2:2594147-2594169 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
928349559 2:30536964-30536986 GGGTGAAGTCAGTTTCTTGCAGG - Intronic
933341428 2:81031105-81031127 GAGTGAAATGTGTTTCTTGTAGG + Intergenic
933676836 2:85064609-85064631 GTGTGCACTGGGTTTCTTTCTGG + Intergenic
937313059 2:120914126-120914148 GCGACAAGTGGGCTTCTTGCCGG + Intronic
938287975 2:130134375-130134397 AGGTGAACTGAGTTTCTTGTAGG + Intergenic
938427620 2:131204502-131204524 AGGTGAACTGAGTTTCTTGTAGG - Intronic
938468553 2:131538524-131538546 AGGTGAACTGAGTTTCTTGTAGG - Intergenic
944377236 2:199060256-199060278 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
945209987 2:207372694-207372716 AGGTGAAGTGGGTTTCTTGTAGG - Intergenic
945334405 2:208574745-208574767 AGGTGAACTGTGTTTCTTGCAGG - Intronic
1169988970 20:11477783-11477805 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
1171060575 20:21954935-21954957 GGGGGAAGTGAGTTTCTTGCAGG + Intergenic
1171508143 20:25656189-25656211 AGGTGAAATGGGTTTCTTGAAGG + Intergenic
1171968862 20:31550681-31550703 ATGTGAACTGTGTTTCATGCAGG + Intronic
1172602757 20:36195226-36195248 GCGTGCTCTGGGCTCCTTGCTGG + Intronic
1173111181 20:40192059-40192081 GCTGGAACTGGGTTTGTTGGAGG + Intergenic
1173111803 20:40197939-40197961 GTGTGAAATGGGTTGGTTGCTGG + Intergenic
1174691098 20:52505871-52505893 AGGTGAACTGTGTTTCTTGTAGG - Intergenic
1176808109 21:13511127-13511149 AGGTGAACTGAGTTTCTTGTAGG - Intergenic
1179771556 21:43622421-43622443 GGGTGAAGTGGGTTTCTTGTAGG - Intronic
1180034646 21:45238740-45238762 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
1182182651 22:28366685-28366707 AGGTGAACTGTGTTTCTTGTAGG - Intronic
1183366766 22:37411018-37411040 GCTAGCACTGGGCTTCTTGCTGG - Intronic
949818062 3:8083131-8083153 AGGTGAAATGGGTTTCTTGGAGG + Intergenic
950503686 3:13380058-13380080 GGGGGCACTGGGGTTCTTGCTGG + Intronic
950800394 3:15546868-15546890 ACGTGAAGTGTGTTTCTTGTAGG + Intergenic
951926138 3:27910575-27910597 ACGTGAACTCCGTTTCTTGGAGG - Intergenic
952066213 3:29574458-29574480 ACGTGACGTGGGTTTCTTGTAGG + Intronic
961717551 3:128868980-128869002 GCCGGAACTGGGTTTCTTTTTGG + Intergenic
962822519 3:139065380-139065402 AGGTGAAGTGGGTTTCTTGTAGG + Intronic
964804312 3:160590193-160590215 AGGTGAACTGTGTTTCTTACAGG - Intergenic
969718583 4:8880571-8880593 GTATGAACTGTGTTTTTTGCTGG - Intergenic
971891665 4:32531367-32531389 GTGTGAAGTGGGTTTCTTGTAGG - Intergenic
973594308 4:52470432-52470454 GCAGGAAGTGGGTTTCTTACAGG - Intergenic
974065461 4:57073087-57073109 GCTTTAAGTAGGTTTCTTGCAGG - Intronic
974292517 4:59950815-59950837 TAGTGAAGTGTGTTTCTTGCAGG - Intergenic
974788919 4:66659786-66659808 AGGTGAAGTGGGTTTCTTGAAGG + Intergenic
977325401 4:95569347-95569369 AAGTGAAGTGTGTTTCTTGCTGG + Intergenic
980545228 4:134252828-134252850 AGGTGAAGTGTGTTTCTTGCAGG + Intergenic
984531692 4:180923829-180923851 GCCAGAACTGGGTTTTTTTCTGG - Intergenic
985524252 5:394123-394145 GCTGGCTCTGGGTTTCTTGCTGG + Intronic
993986515 5:94603667-94603689 ATGTGAGATGGGTTTCTTGCAGG - Intronic
996956630 5:129190679-129190701 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
997068595 5:130592378-130592400 AAGTGAACTGAGTTTCTTCCAGG - Intergenic
997096125 5:130913920-130913942 AAGTGAAGTGGGTTTCTTGAAGG - Intergenic
998406078 5:141875634-141875656 GCTGGAAGTGGGTGTCTTGCTGG - Intronic
999373737 5:151072032-151072054 GCGTCGACTGGTTTCCTTGCTGG - Intronic
999660246 5:153854517-153854539 AGGTGAAGTGGGTTTCTTGTAGG + Intergenic
1000941253 5:167363362-167363384 GCCTAAACTGGGATTCTTGCCGG - Intronic
1001980192 5:176033006-176033028 ACCTGGACTGTGTTTCTTGCTGG - Intronic
1002237190 5:177810657-177810679 ACCTGGACTGTGTTTCTTGCTGG + Intergenic
1006277135 6:33013998-33014020 TTCTGAACTGGGTTGCTTGCTGG - Intergenic
1006285670 6:33092216-33092238 GTGTAATCTGAGTTTCTTGCTGG + Intergenic
1007836557 6:44678402-44678424 GCCAGCCCTGGGTTTCTTGCAGG - Intergenic
1009748346 6:67849269-67849291 AGGTGAAATGTGTTTCTTGCAGG - Intergenic
1009875667 6:69501650-69501672 GGGTGAAGTAGGTTTCTTGTAGG - Intergenic
1010775653 6:79881918-79881940 GGGTGAAGTGTGTTTCTAGCAGG - Intergenic
1011508114 6:88070013-88070035 AGGTGAAGTGGGTTTCTTGAAGG + Intergenic
1012505270 6:99939079-99939101 AGGTGAAGTGGGTTTCTTGTAGG + Intronic
1013557814 6:111274393-111274415 GGGTGAAGTGAGTTTTTTGCAGG + Intergenic
1014130930 6:117831819-117831841 GAGTGAAGTGAGTTTCTTGTGGG - Intergenic
1014439131 6:121453497-121453519 GCCTGATCTGGCTTTCATGCTGG + Intergenic
1014466298 6:121760640-121760662 GAGTGAACTGTCTGTCTTGCTGG - Intergenic
1014753672 6:125280377-125280399 GAGTGAACAGTGTGTCTTGCTGG - Intronic
1014827153 6:126059459-126059481 CCATGAACTGCTTTTCTTGCTGG - Intergenic
1015257420 6:131194933-131194955 AGGTGAAGTGTGTTTCTTGCAGG + Intronic
1017933936 6:158987359-158987381 AGGTGAAGTGGGTTTCTTGAAGG + Intronic
1020835250 7:13141489-13141511 GCTTGAACTGGGTTTAATGTTGG - Intergenic
1021529596 7:21629816-21629838 AGGTGAAGTGGGTTTCTTGTAGG + Intronic
1022016870 7:26357772-26357794 AGGAGAACTGGGTTTCTAGCTGG + Intronic
1022966554 7:35479530-35479552 AGGTGAAGTGGGTTTCTTGCAGG - Intergenic
1023087052 7:36581203-36581225 GTGTGAACTGGGTTGCTTCTTGG + Intronic
1026941742 7:74291001-74291023 GCCTGAAGGGGGTTTCGTGCAGG + Intronic
1030113301 7:106044427-106044449 GCATTAACTGGGTTTCTTTCTGG + Intergenic
1030241854 7:107335716-107335738 AGGTGAAGTAGGTTTCTTGCAGG - Intronic
1030384523 7:108851950-108851972 GAGTGAATTGGGTTTTTTGTAGG + Intergenic
1030752759 7:113250797-113250819 GGGTGAAGTGTGTTTCTTGTAGG - Intergenic
1032710384 7:134455899-134455921 GCTTGGACAGGGTTTCTTTCTGG - Intronic
1035016275 7:155769299-155769321 CCGTCATCTGTGTTTCTTGCGGG + Intronic
1036916604 8:12810309-12810331 GTGAGAACTGGGTGTCTTCCAGG - Intergenic
1036998870 8:13693669-13693691 ACATGAAGTGGGTTTCTTGCAGG + Intergenic
1039420921 8:37439244-37439266 AGGTGAAGTGTGTTTCTTGCAGG + Intergenic
1040486035 8:47872532-47872554 AGGTGAAGTGTGTTTCTTGCAGG - Intronic
1045323363 8:101098538-101098560 GCGGGAACTGGGGTTCTGGAAGG - Intergenic
1046449166 8:114365406-114365428 AGGTGAAGTGTGTTTCTTGCAGG - Intergenic
1050807297 9:9696698-9696720 AGGTGAAATGGGTTTCTTGTAGG + Intronic
1051990845 9:23150986-23151008 AGGTGAAGTGTGTTTCTTGCAGG + Intergenic
1053027936 9:34746461-34746483 GAGTGAATTGGGTTTATTTCAGG + Intergenic
1056148509 9:83760137-83760159 GGGTGAAATGTGTTTCTTGTAGG - Intronic
1060886633 9:127159184-127159206 GCGTGCACTGGGGTTCTGACTGG - Intronic
1061480495 9:130895653-130895675 GCCTGAGCTGGGGTTCCTGCTGG + Intergenic
1187945961 X:24426754-24426776 GTGTTAACTGGGTTTGCTGCCGG - Intergenic
1190587241 X:51958879-51958901 AGGTGAAGTGTGTTTCTTGCAGG + Intergenic
1190899297 X:54653619-54653641 TGGTGAAGTGTGTTTCTTGCAGG - Intergenic
1192803485 X:74490418-74490440 GGTTGAAGTGGGTTGCTTGCAGG + Intronic
1193022795 X:76809550-76809572 ATGTGAAGTGTGTTTCTTGCAGG - Intergenic
1194559166 X:95399114-95399136 TCGTGAAGTGTGTTTCTTGTAGG - Intergenic
1194787388 X:98103786-98103808 ATGTGAAGTGTGTTTCTTGCAGG + Intergenic
1197010305 X:121553217-121553239 AGGTGAACTGTGTTTCTTGTAGG - Intergenic
1197623295 X:128776545-128776567 AGGTGAAGTGTGTTTCTTGCAGG + Intergenic
1198293956 X:135266371-135266393 GAGTGAAGTATGTTTCTTGCAGG - Intronic
1199196321 X:145035040-145035062 AGGTGAACTGTGTTTCTTGCAGG + Intergenic