ID: 1123716696

View in Genome Browser
Species Human (GRCh38)
Location 15:23039149-23039171
Sequence GTCACGGGGAAAGCGTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716696_1123716706 19 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716696_1123716701 -5 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716701 15:23039167-23039189 GTGACGATCAGGACGCGTCCCGG 0: 1
1: 0
2: 0
3: 0
4: 20
1123716696_1123716707 20 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716696_1123716702 -4 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20
1123716696_1123716703 11 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716696 Original CRISPR GTCACGGGGAAAGCGTGAAC TGG (reversed) Intronic