ID: 1123716697

View in Genome Browser
Species Human (GRCh38)
Location 15:23039156-23039178
Sequence ACGCTTTCCCCGTGACGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716690_1123716697 29 Left 1123716690 15:23039104-23039126 CCAGAGCGCTGGGGTTGCAGGCG 0: 1
1: 1
2: 201
3: 8579
4: 148445
Right 1123716697 15:23039156-23039178 ACGCTTTCCCCGTGACGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123716689_1123716697 30 Left 1123716689 15:23039103-23039125 CCCAGAGCGCTGGGGTTGCAGGC 0: 1
1: 5
2: 407
3: 16011
4: 248983
Right 1123716697 15:23039156-23039178 ACGCTTTCCCCGTGACGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123716694_1123716697 -4 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716697 15:23039156-23039178 ACGCTTTCCCCGTGACGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123716693_1123716697 0 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716697 15:23039156-23039178 ACGCTTTCCCCGTGACGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716697 Original CRISPR ACGCTTTCCCCGTGACGATC AGG Intronic