ID: 1123716698

View in Genome Browser
Species Human (GRCh38)
Location 15:23039163-23039185
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716698_1123716711 30 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716698_1123716706 5 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716698_1123716703 -3 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716698_1123716710 26 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716698_1123716707 6 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716698 Original CRISPR GACGCGTCCTGATCGTCACG GGG (reversed) Intronic