ID: 1123716699

View in Genome Browser
Species Human (GRCh38)
Location 15:23039164-23039186
Sequence GGACGCGTCCTGATCGTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716699_1123716706 4 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716699_1123716707 5 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716699_1123716711 29 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716699_1123716703 -4 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716699_1123716710 25 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716699 Original CRISPR GGACGCGTCCTGATCGTCAC GGG (reversed) Intronic
1123716699 15:23039164-23039186 GGACGCGTCCTGATCGTCACGGG - Intronic
1139971329 16:70777497-70777519 GGACGTGACCTGATTGTCTCAGG - Intronic
1142008971 16:87704250-87704272 GGGAGGGTCCTGAACGTCACGGG + Intronic
1142009024 16:87704410-87704432 GGGAGGGTCCTGAACGTCACGGG + Intronic
1142009047 16:87704484-87704506 GGGAGGGTCCTGAACGTCACGGG + Intronic
1142009067 16:87704534-87704556 GGAGGGGTCCTGAACGTCACGGG + Intronic
1152021632 17:77782794-77782816 GGACAGGGCCTGACCGTCACAGG + Intergenic
1158478588 18:57802336-57802358 GGACGCGACCCGACAGTCACCGG + Intronic
952697904 3:36291532-36291554 TGATGCTTCCTGATCCTCACAGG + Intergenic
960940239 3:122928575-122928597 GTGCGAGTCCTGATCGTCGCCGG - Exonic
961676892 3:128573091-128573113 AGACACGTCCTCATCCTCACAGG + Exonic
972431835 4:38990443-38990465 GGACCCATCCTGATCGTTGCTGG - Intronic
985381062 4:189395403-189395425 GGATGTGCCCTGATGGTCACAGG - Intergenic
1018612800 6:165661290-165661312 GGCCGCGTCCTGTTGGTCCCGGG - Intronic
1020210374 7:6154193-6154215 GGATGGGTCCTGAGCGTCCCGGG - Exonic