ID: 1123716700

View in Genome Browser
Species Human (GRCh38)
Location 15:23039165-23039187
Sequence GGGACGCGTCCTGATCGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716700_1123716703 -5 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716700_1123716711 28 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716700_1123716707 4 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716700_1123716706 3 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716700_1123716710 24 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716700 Original CRISPR GGGACGCGTCCTGATCGTCA CGG (reversed) Intronic
1074818667 10:117163411-117163433 GGGACGCCTCCCGAGCGTCGAGG - Intergenic
1077343430 11:2036020-2036042 GGGACTCCTCCTGTTCCTCACGG + Intergenic
1202826416 11_KI270721v1_random:91209-91231 GGGACTCCTCCTGTTCCTCACGG + Intergenic
1104723245 12:131058275-131058297 GGGAAGCGTCGTGAGCGTCCTGG + Intronic
1106514744 13:30444053-30444075 GGGACCCTGCCTGATCATCAGGG + Intergenic
1116069668 14:40027304-40027326 GTGAAGCATCCTGAACGTCATGG - Intergenic
1123716700 15:23039165-23039187 GGGACGCGTCCTGATCGTCACGG - Intronic
1128640595 15:69333499-69333521 GGGACGCCTCCTTATCTTCCAGG - Intronic
1142008970 16:87704249-87704271 GGGGAGGGTCCTGAACGTCACGG + Intronic
1142009023 16:87704409-87704431 GGGGAGGGTCCTGAACGTCACGG + Intronic
1142009046 16:87704483-87704505 GGGGAGGGTCCTGAACGTCACGG + Intronic
1142009066 16:87704533-87704555 GGGAGGGGTCCTGAACGTCACGG + Intronic
1142009078 16:87704570-87704592 GGGGAGGGTCCTGAACGTCACGG + Intronic
1142364077 16:89640531-89640553 GGGACGCGTCCTGATCTTCCAGG + Intergenic
930912487 2:56646460-56646482 GGGAGGCCTGCTGATGGTCATGG - Intergenic
1181185817 22:21102957-21102979 GGGGCGCCCCCTGATGGTCACGG - Intergenic
1183567907 22:38629666-38629688 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567914 22:38629723-38629745 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567921 22:38629780-38629802 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567928 22:38629837-38629859 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567935 22:38629894-38629916 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567943 22:38629955-38629977 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567950 22:38630013-38630035 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567957 22:38630070-38630092 GGCACGCTTCCTGATGGTAAAGG - Intronic
1183567964 22:38630128-38630150 GGCACGCTTCCTGATGGTAAAGG - Intronic
952750784 3:36823234-36823256 GGGACCTGTCCTTATCCTCATGG + Intergenic
1008563057 6:52740618-52740640 GAGCCACGTCCTGAACGTCAGGG - Intergenic
1018371067 6:163169200-163169222 GAGACTCATCCTGATCATCATGG - Intronic
1018612801 6:165661291-165661313 GGGCCGCGTCCTGTTGGTCCCGG - Intronic
1020210375 7:6154194-6154216 GGGATGGGTCCTGAGCGTCCCGG - Exonic
1048829399 8:138461276-138461298 GGGATGCATCCTGGTCATCAAGG + Intronic
1187882660 X:23861191-23861213 GGGACGTGACCTGATCATGAAGG + Intronic
1195718433 X:107841337-107841359 GGGATGCGACCTGATGGTCTCGG - Exonic