ID: 1123716702

View in Genome Browser
Species Human (GRCh38)
Location 15:23039168-23039190
Sequence TGACGATCAGGACGCGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 20}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716696_1123716702 -4 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20
1123716694_1123716702 8 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20
1123716695_1123716702 -3 Left 1123716695 15:23039148-23039170 CCCAGTTCACGCTTTCCCCGTGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20
1123716693_1123716702 12 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716702 Original CRISPR TGACGATCAGGACGCGTCCC GGG Intronic