ID: 1123716703

View in Genome Browser
Species Human (GRCh38)
Location 15:23039183-23039205
Sequence GTCCCGGGTAACACGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716699_1123716703 -4 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716700_1123716703 -5 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716698_1123716703 -3 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716694_1123716703 23 Left 1123716694 15:23039137-23039159 CCGGCAAGAAACCCAGTTCACGC 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716695_1123716703 12 Left 1123716695 15:23039148-23039170 CCCAGTTCACGCTTTCCCCGTGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716693_1123716703 27 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716696_1123716703 11 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716703 Original CRISPR GTCCCGGGTAACACGCCCTG TGG Intronic
901061394 1:6473510-6473532 GGCCCTGGAAACCCGCCCTGGGG - Intronic
905508219 1:38497440-38497462 GTCTCGGGTAACACGGTCTTTGG + Intergenic
1067374092 10:45711470-45711492 GTCCCTGGCAACACGTGCTGTGG + Intergenic
1067379594 10:45760792-45760814 GTCCCTGGCAACACGTGCTGTGG - Intronic
1067881920 10:50053224-50053246 GTCCCTGGCAACACGTGCTGTGG + Intergenic
1067887292 10:50101449-50101471 GTCCCTGGCAACACGTGCTGTGG - Intronic
1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG + Exonic
1073568107 10:104553094-104553116 GACAGGGGTAACACGCCCTCTGG - Intergenic
1074143339 10:110696283-110696305 GTCCTGGGTAAGAAGTCCTGGGG - Intronic
1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG + Intronic
1082854783 11:57796729-57796751 GTCCCGGGTGACCCGCATTGAGG + Exonic
1084690110 11:70720161-70720183 CTCCCAGGTACCAGGCCCTGGGG - Intronic
1085437421 11:76520638-76520660 GTCCAAGGTAACATGCTCTGAGG - Intronic
1088981894 11:114871586-114871608 GGCTCGTGTAAAACGCCCTGTGG + Intergenic
1092412998 12:8268440-8268462 GTCCGTGGGAACAGGCCCTGGGG + Intergenic
1102252518 12:111397162-111397184 GTCCCAGGCATCAGGCCCTGAGG - Intergenic
1102458783 12:113087468-113087490 GTCCTGGGGAACACAGCCTGGGG - Intronic
1111092147 13:83461932-83461954 GTCCTGGTTACCACTCCCTGGGG - Intergenic
1118846523 14:69551472-69551494 ATGCTGGGTAACAGGCCCTGAGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG + Intronic
1129452553 15:75659092-75659114 GTCCTGGGTACCCAGCCCTGCGG + Exonic
1134548981 16:15130558-15130580 TGCCCGGGTTACAGGCCCTGTGG - Intronic
1138423554 16:56915458-56915480 GTCCCTCGTAGCAAGCCCTGAGG - Exonic
1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG + Intronic
1162621620 19:11848627-11848649 GCCCTGGGTATCAGGCCCTGCGG - Intergenic
1165329107 19:35131584-35131606 GACCCGGCTTCCACGCCCTGGGG + Intronic
937086383 2:119174623-119174645 GTCCCGGGTAGCATGCCCCCTGG + Intergenic
942084139 2:172428262-172428284 GTCCCAGCAAACACGCCCGGAGG - Intronic
946175510 2:217919831-217919853 GTCCCGGGTCAGGCACCCTGGGG - Intronic
947846957 2:233252057-233252079 GCCCCGGGTAACCCGCGCTTGGG + Intronic
1173606185 20:44333421-44333443 GCCCCGGGTCACACATCCTGTGG - Intergenic
1175537213 20:59722924-59722946 GTGCTGGGAAAGACGCCCTGTGG + Intronic
1176222784 20:63978046-63978068 GTCCCGGGCTGCAGGCCCTGTGG - Intronic
1184116774 22:42426898-42426920 GTCCCAGGTGCCACGCCCTGAGG + Intronic
1185127129 22:49017542-49017564 GTCCCTGGGCACAGGCCCTGGGG + Intergenic
951604836 3:24421595-24421617 GTCCTGGGTGGCACGTCCTGTGG - Intronic
957085279 3:75671494-75671516 GTCCCGTGCATCACGGCCTGAGG - Intergenic
957228684 3:77482499-77482521 ATCTCTGGTAACACTCCCTGTGG + Intronic
989719254 5:44504834-44504856 GCCCTGGGTAATAAGCCCTGAGG - Intergenic
1002559624 5:180072303-180072325 CTCCCGGGCTCCACGCCCTGCGG - Intergenic
1046343067 8:112884088-112884110 GTCCAGGTTAAAACACCCTGTGG - Intronic
1057775161 9:98001945-98001967 GTCCAGAGTCACACACCCTGTGG + Intronic
1062181938 9:135195585-135195607 GCCCAGGGTGACACGCGCTGGGG + Intergenic
1062429179 9:136519404-136519426 GCCCCGGCTACCCCGCCCTGCGG + Intronic
1189084003 X:38001092-38001114 GTCCCTGGTCACAGGCCCAGGGG + Intronic