ID: 1123716706

View in Genome Browser
Species Human (GRCh38)
Location 15:23039191-23039213
Sequence TAACACGCCCTGTGGTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716695_1123716706 20 Left 1123716695 15:23039148-23039170 CCCAGTTCACGCTTTCCCCGTGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716700_1123716706 3 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716699_1123716706 4 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716696_1123716706 19 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58
1123716698_1123716706 5 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716706 Original CRISPR TAACACGCCCTGTGGTGCGC AGG Intronic
903230809 1:21921381-21921403 TAACAGGCCCTGTGGTTTGGTGG - Intronic
906049688 1:42859880-42859902 TAACACTCACTATGGTGCCCAGG + Intergenic
913688262 1:121254345-121254367 TAACACGCCTTGGGGAGGGCAGG - Intronic
923045912 1:230355559-230355581 TAACAGGCCCTGTGGTACCAAGG - Intronic
1065909213 10:30286870-30286892 TAACACGCCCTCTGGGGCTCTGG - Intergenic
1077000818 11:321344-321366 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077000875 11:321617-321639 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077000893 11:321695-321717 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077000920 11:321812-321834 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077000937 11:321890-321912 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077000972 11:322046-322068 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077000999 11:322163-322185 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077001016 11:322241-322263 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077001043 11:322358-322380 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077001060 11:322436-322458 TAACCCTCACTGTGGTGCCCAGG + Intronic
1077001078 11:322514-322536 TAACCCTCACTGTGGTGCCCAGG + Intronic
1079114916 11:17634816-17634838 TGACAGGCCCTGTGGTCCCCGGG + Intronic
1104090617 12:125513964-125513986 TGGCACCCCCTGTGGTGTGCTGG - Intronic
1104405837 12:128515992-128516014 TCACCCGCCCTGTGGTTCGCTGG + Intronic
1104569134 12:129909679-129909701 GAACATGCCCTGTGCTGGGCCGG + Intergenic
1104706329 12:130950236-130950258 AAACATGCTCTGTTGTGCGCAGG + Intergenic
1113371087 13:109726155-109726177 TGACTCGCCTTGTGGTGGGCAGG - Intergenic
1119485017 14:74981410-74981432 CAAGACTCCCTGTGGGGCGCAGG - Intergenic
1123716706 15:23039191-23039213 TAACACGCCCTGTGGTGCGCAGG + Intronic
1129362017 15:75030016-75030038 TAAAAGGCCCTGGGGTGGGCTGG - Intronic
1129893676 15:79088864-79088886 TGACAAGCCATGTGGTGAGCAGG - Intronic
1139923282 16:70472688-70472710 TAACACGGCCCGTGCTGCTCTGG - Intronic
1140040372 16:71403503-71403525 TAACATGTCCTGTTGTGAGCAGG + Intergenic
1142301710 16:89262459-89262481 TAACACGCCCTCTGGGGCTTTGG - Intergenic
1144466162 17:15499342-15499364 CAACAGCCCCTGTGGTGTGCTGG + Intronic
1146419635 17:32671149-32671171 TAACACTCCCTTTGGGGCTCTGG + Intronic
1148714787 17:49708176-49708198 TAGGACACCCTGTGGTGCTCTGG - Exonic
1152339841 17:79718111-79718133 TAACAAGCCCTGTGCTCTGCTGG - Intergenic
1152540541 17:80972203-80972225 TGACAGGCCCTGTGCTGCCCTGG - Intergenic
1155637745 18:27975585-27975607 TAACACGCCCTCTGGGGCCTTGG - Intronic
1168541121 19:57211320-57211342 TAACAGGCCCTTTTGTGTGCTGG + Intronic
929830883 2:45345437-45345459 TATCACACCCTGTGGGTCGCAGG + Intergenic
931866687 2:66419941-66419963 TAACCCGTCATGTGGTGGGCGGG - Intergenic
940026362 2:149212507-149212529 TAATAGGCCATGTGGTGAGCTGG - Intronic
943466219 2:188232172-188232194 TAAAATGCCCTCTGGTGAGCTGG - Intergenic
1169399126 20:5264917-5264939 TACCCTGCCCTGTGGTGCTCTGG - Intergenic
1183234336 22:36605979-36606001 TAAGAAGCCCTGTGGTGTGGTGG + Intronic
951134177 3:19083991-19084013 TAACATACCCTGTGGGGCTCCGG + Intergenic
956834596 3:73086034-73086056 TAACACACCCTTTGGAGAGCAGG - Intergenic
963925159 3:150943779-150943801 TAACACACCCTCTGGGGCCCTGG + Intronic
979200442 4:117971460-117971482 TAAAACACCCTGTGGTGTGGGGG + Intergenic
983172486 4:164551838-164551860 TAACACGCCCTCTGGGGCCTTGG - Intergenic
997469686 5:134110131-134110153 TAACAAGCCCTGTGAAGCTCTGG + Intergenic
1001822588 5:174721414-174721436 TAACGCGCCCCGGGGAGCGCGGG + Intergenic
1002999701 6:2319550-2319572 TAACACGCCCTCTGGGGCCTTGG - Intergenic
1003047419 6:2746639-2746661 AAACATCCCCTGTGGTGCACTGG - Intronic
1010327493 6:74581839-74581861 TAACACACCCTTTGGGGCACTGG - Intergenic
1013161632 6:107550612-107550634 TAAGTCACCCTGTGGTGCCCGGG - Intronic
1018974504 6:168554908-168554930 GCACACGCCCTGTGGTGAGAGGG - Intronic
1023599236 7:41865190-41865212 TAACATGCCCTATGGGGCTCTGG - Intergenic
1042670646 8:71259268-71259290 TAACATGAACTGTGGTGGGCGGG - Intronic
1058828073 9:108792869-108792891 TAACACGCCCTCTGGGGCCTTGG + Intergenic
1059494771 9:114700344-114700366 TAACATGCCCTCTGGGGCTCAGG + Intergenic
1059800366 9:117744309-117744331 TAACACCCCCTGTAGTGCTGAGG - Intergenic
1189277592 X:39797993-39798015 TTACCTGCCCTGTGGTGAGCTGG + Intergenic
1195715282 X:107812361-107812383 TAACATGCCCTGTCCTGGGCTGG - Intergenic