ID: 1123716707

View in Genome Browser
Species Human (GRCh38)
Location 15:23039192-23039214
Sequence AACACGCCCTGTGGTGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716698_1123716707 6 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716699_1123716707 5 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716696_1123716707 20 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716695_1123716707 21 Left 1123716695 15:23039148-23039170 CCCAGTTCACGCTTTCCCCGTGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716700_1123716707 4 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716707 Original CRISPR AACACGCCCTGTGGTGCGCA GGG Intronic