ID: 1123716707

View in Genome Browser
Species Human (GRCh38)
Location 15:23039192-23039214
Sequence AACACGCCCTGTGGTGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716695_1123716707 21 Left 1123716695 15:23039148-23039170 CCCAGTTCACGCTTTCCCCGTGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716698_1123716707 6 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716700_1123716707 4 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716696_1123716707 20 Left 1123716696 15:23039149-23039171 CCAGTTCACGCTTTCCCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52
1123716699_1123716707 5 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716707 Original CRISPR AACACGCCCTGTGGTGCGCA GGG Intronic
913688261 1:121254344-121254366 AACACGCCTTGGGGAGGGCAGGG - Intronic
914040117 1:144041986-144042008 AACACGCCTTGGGGAGGGCAGGG - Intergenic
914149340 1:145025933-145025955 AACACGCCTTGGGGAGGGCAGGG + Intronic
915387804 1:155512260-155512282 ACCACGCCCTGTGCTGCGCCTGG - Intronic
920475581 1:206272843-206272865 AACACGCCTTGGGGAGGGCAGGG - Intronic
922923315 1:229327498-229327520 ATCACTCCCTGTTGTGCGGAGGG - Intronic
1065909212 10:30286869-30286891 AACACGCCCTCTGGGGCTCTGGG - Intergenic
1070725104 10:78782415-78782437 AGCATTCCCTGTGGTGAGCAGGG - Intergenic
1077218641 11:1405559-1405581 AACATGCCCTGTCCTGCCCAGGG + Intronic
1080385782 11:31810436-31810458 AAGAGGCTCTGTGGTGCCCAAGG - Intronic
1084493578 11:69491133-69491155 AACACACCCTGTGATGGGGAGGG + Intergenic
1090238682 11:125166758-125166780 AACCCGGCCTTTGGTGCGCCCGG + Intronic
1101816244 12:108148253-108148275 AACACCCCCTGAGGTGGGGAAGG + Intronic
1102770641 12:115473081-115473103 AACGTGCCCTGTTGTGGGCATGG - Intergenic
1104706330 12:130950237-130950259 AACATGCTCTGTTGTGCGCAGGG + Intergenic
1106036412 13:26049358-26049380 ATGACGCCCTGTGTTGTGCATGG - Intronic
1108128085 13:47266834-47266856 AACAACCCCTGTGGTCGGCAAGG - Intergenic
1120843376 14:89106321-89106343 AACACTCACTGTGCTGAGCAAGG + Intergenic
1123716707 15:23039192-23039214 AACACGCCCTGTGGTGCGCAGGG + Intronic
1129893675 15:79088863-79088885 GACAAGCCATGTGGTGAGCAGGG - Intronic
1140040373 16:71403504-71403526 AACATGTCCTGTTGTGAGCAGGG + Intergenic
1144466163 17:15499343-15499365 AACAGCCCCTGTGGTGTGCTGGG + Intronic
1150239618 17:63621763-63621785 TACACGCCCTGTGCTGGGCACGG + Intergenic
1167345668 19:48944270-48944292 AACATGCCAGGTGGTGCACAGGG - Intronic
1168400129 19:56080845-56080867 GAGAGGCCCTGTGGGGCGCAAGG - Intergenic
929830884 2:45345438-45345460 ATCACACCCTGTGGGTCGCAGGG + Intergenic
931462994 2:62464268-62464290 AACACGCCCTGTGGGGCTTTTGG + Intergenic
932050808 2:68395955-68395977 AACTCACCATGTGGTGTGCAAGG + Exonic
938244017 2:129763642-129763664 GCCAGGCCCTGTGGTGGGCACGG - Intergenic
943254965 2:185583309-185583331 AACACTGCCTGTGGTGGCCAAGG + Intergenic
1179407424 21:41137249-41137271 ATCACGCACAGTGGTGAGCAGGG - Intergenic
1179514171 21:41895009-41895031 AACACGCACTGAGGTGCGGCTGG + Intronic
1180193642 21:46181251-46181273 CAAACGCCCTGTGGTGAGCGTGG + Intronic
1183991698 22:41601244-41601266 CACACACCCTGTGCTGCCCACGG + Intronic
959277219 3:104291652-104291674 AACATACCCAGTGGTGAGCATGG - Intergenic
959864669 3:111252635-111252657 AACAAACCCTGTGGTGCTCTTGG - Intronic
972111735 4:35570187-35570209 CACATGTCCTGTGGTGAGCATGG - Intergenic
975166993 4:71187675-71187697 AAGACGCCCAGTTGCGCGCAGGG - Intronic
985821588 5:2164207-2164229 ACCAGGCCCAGAGGTGCGCAGGG - Intergenic
988571710 5:32373962-32373984 AACACACCCTGTGAAGTGCATGG + Intronic
989853819 5:46252649-46252671 AAAAAGGCCTGTGGTGAGCAGGG - Intergenic
1005886244 6:30100185-30100207 ACCAGGCCCTGTAGTGCTCAAGG + Intergenic
1010750335 6:79610448-79610470 AGCAGGCCCTGTTGTGCGTAAGG - Intergenic
1015720581 6:136237008-136237030 CACACGCCCTGTGTTCAGCAGGG - Intronic
1015790452 6:136959642-136959664 AACACGCCCTCTGGGGCTCCAGG + Intergenic
1018974503 6:168554907-168554929 CACACGCCCTGTGGTGAGAGGGG - Intronic
1023871962 7:44268170-44268192 AAGACGCCCTGGACTGCGCAGGG + Intronic
1024046100 7:45586815-45586837 AACATGCCCAGTGCTGTGCAGGG + Intronic
1027047086 7:74998245-74998267 ACCAAGCCCTGTGCTGGGCATGG + Intronic
1029385910 7:100243395-100243417 ACCAAGCCCTGTGCTGGGCATGG - Intronic
1043382769 8:79721132-79721154 ATCAGGCCCTTTGGTGCTCAAGG - Intergenic
1049422632 8:142523721-142523743 GACACCACCTGTGGTGCCCATGG - Intronic
1051000199 9:12272874-12272896 AACCAACCCTGTGGTGCACAGGG - Intergenic
1055961403 9:81823748-81823770 AACAGGCCCTGTAGTCAGCAGGG - Intergenic
1059494772 9:114700345-114700367 AACATGCCCTCTGGGGCTCAGGG + Intergenic
1186441106 X:9587311-9587333 AACACCCCCAGTGGTGGGGAGGG + Intronic