ID: 1123716710

View in Genome Browser
Species Human (GRCh38)
Location 15:23039212-23039234
Sequence GGGCACCGCGCCGAGAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716698_1123716710 26 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716708_1123716710 -9 Left 1123716708 15:23039198-23039220 CCCTGTGGTGCGCAGGGCACCGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716704_1123716710 4 Left 1123716704 15:23039185-23039207 CCCGGGTAACACGCCCTGTGGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716700_1123716710 24 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716709_1123716710 -10 Left 1123716709 15:23039199-23039221 CCTGTGGTGCGCAGGGCACCGCG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716699_1123716710 25 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90
1123716705_1123716710 3 Left 1123716705 15:23039186-23039208 CCGGGTAACACGCCCTGTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716710 Original CRISPR GGGCACCGCGCCGAGAGCGC TGG Intronic
900117191 1:1033789-1033811 GGGCCCGGGGCCGGGAGCGCTGG - Intronic
901361305 1:8703222-8703244 GGGCACCGCGGCGCGGGCGCAGG + Intronic
901890186 1:12256431-12256453 GGGGACTGTGCCGAGACCGCAGG - Exonic
908258760 1:62322965-62322987 AGCCACCGCGCCCAGAGAGCTGG - Intergenic
909643204 1:77888974-77888996 AGGCACCCCGCCGAGCCCGCAGG - Intronic
915340999 1:155176738-155176760 GGGCACCGCCCGGAGACTGCAGG + Intronic
922851272 1:228735726-228735748 GGGCATCGATCCGCGAGCGCGGG - Exonic
923008056 1:230067540-230067562 GGCCTCCGCGCCGAGTGCCCAGG + Intronic
923191872 1:231627307-231627329 GCGCACCGCAACGAGAGTGCAGG - Intronic
1065483597 10:26216686-26216708 GGGCACCGCGCGGGGACCGGCGG - Exonic
1068910475 10:62374237-62374259 GGGCACCGCGCCGTGGGTGCGGG - Exonic
1070148596 10:73792072-73792094 AGGCACCTGGCCGAGAGGGCAGG - Exonic
1073363569 10:102918888-102918910 GGGCCCCGCGCCGCCAGAGCCGG + Exonic
1076977929 11:189586-189608 CGCCACCGGGACGAGAGCGCGGG + Intronic
1077246902 11:1544075-1544097 GGGCACCCTGCCGAGTGCACAGG - Intergenic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1078594522 11:12674753-12674775 GGGCACCGAGCAGAGGGCGGGGG + Exonic
1080475259 11:32584112-32584134 GGGCCCCGCGCTGGGACCGCCGG - Intronic
1081715207 11:45245168-45245190 GGGCACTGCACCAAGAGAGCTGG + Intronic
1082810583 11:57476843-57476865 GGGAGCCCGGCCGAGAGCGCAGG - Exonic
1083743426 11:64722832-64722854 GGGCGCCGCGCTGAGAGGGCTGG - Intronic
1085266476 11:75240767-75240789 GGGCTCCGAGCCGAGTGGGCAGG - Intergenic
1086666640 11:89491499-89491521 GGGCCGCGCGCTCAGAGCGCTGG - Intronic
1089564635 11:119364229-119364251 GGGCCCCGCGACGTCAGCGCTGG + Intronic
1091391553 12:129256-129278 GGGCACAGCTCCAGGAGCGCTGG - Intronic
1096464359 12:51840138-51840160 GGGCACTGCGGGGAGGGCGCAGG + Intergenic
1099204435 12:79711357-79711379 GGGTCCCGCACCGGGAGCGCAGG - Intergenic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1103374609 12:120446175-120446197 GGACACAGCGCCGAGAATGCAGG + Intronic
1103390012 12:120565473-120565495 AGGAACGCCGCCGAGAGCGCAGG + Exonic
1103595982 12:122024370-122024392 GAGCACCGCGCCCTGGGCGCAGG + Intronic
1104690032 12:130818698-130818720 GGGCTCCGCTCCGAATGCGCTGG - Intronic
1104803315 12:131569428-131569450 GGGCACCACACTGAGAGGGCGGG + Intergenic
1106226817 13:27792504-27792526 GGGCACCGCCCAAAGAGCGCGGG - Intergenic
1113082787 13:106535400-106535422 GGGCAGCGGCCCGAGCGCGCGGG + Intergenic
1113655769 13:112067158-112067180 GGGCGGCGCGCCGCGTGCGCTGG - Intergenic
1121546484 14:94767431-94767453 CGGGAACGCGCCCAGAGCGCTGG - Intergenic
1122434949 14:101689103-101689125 GGGCTGCGCGCCGAGCTCGCGGG + Intergenic
1122770322 14:104094934-104094956 GGGCACCGTTCCGAGAGCCCAGG - Intronic
1122862425 14:104588560-104588582 GGGCACTGCGGCCAGAGGGCAGG - Intronic
1123716710 15:23039212-23039234 GGGCACCGCGCCGAGAGCGCTGG + Intronic
1125950451 15:43746856-43746878 AGGCGCCTCGCCGAGAGCGGGGG + Intronic
1132583569 16:696050-696072 GGGCATCGGGACGAGAGCCCAGG + Intronic
1134849787 16:17470593-17470615 CGGCCCCGCGCCGGGAGCGCCGG - Exonic
1142120248 16:88383407-88383429 GGGCCGGGCGCCGCGAGCGCTGG - Intergenic
1143078791 17:4366410-4366432 GGGCCCCGCGACCGGAGCGCCGG + Exonic
1144004923 17:11091111-11091133 GGGCACCTAGACGAGAGGGCAGG + Intergenic
1149610422 17:57955040-57955062 GGGAGCCGCGCCGACAGCCCCGG + Intronic
1152468006 17:80476539-80476561 GAGCGCGGCGCCCAGAGCGCGGG - Exonic
1158965254 18:62616827-62616849 GGGCTCCACGCTGAGAGCACCGG + Intergenic
1160182981 18:76651649-76651671 GGGCACCGCGCCCAGCCTGCTGG - Intergenic
1160864315 19:1250320-1250342 GGGCCCCGCGCCGGCAGCTCCGG - Exonic
1165242802 19:34481536-34481558 AGGCACCGCGGGGAGAGCCCAGG - Intergenic
1168609261 19:57786285-57786307 GGCCACCGCGGCGAGGACGCAGG - Intronic
926311603 2:11679726-11679748 GGGCACCGCACAGAGACTGCCGG - Intronic
926914338 2:17878500-17878522 GCGCCCCGGGCCGAGGGCGCGGG - Intronic
940215082 2:151296087-151296109 GGGCCCCGCACTGAGAGCGGCGG + Intergenic
940293491 2:152099198-152099220 CGGGACCCCGCCGCGAGCGCGGG - Intergenic
942276380 2:174326719-174326741 GGGCGCTCCGCCGAGGGCGCGGG + Intergenic
942446089 2:176080017-176080039 GGGCAACGCGCGGAGGGCTCAGG + Exonic
1169113349 20:3046804-3046826 GGGCACCGCGACGCGGGCGCTGG + Intronic
1171877642 20:30593609-30593631 GCGCAACCCGCCCAGAGCGCAGG - Intergenic
1176384127 21:6128649-6128671 GGGCACGGAGCGGAGAGCCCAGG - Intergenic
1179739347 21:43409595-43409617 GGGCACGGAGCGGAGAGCCCAGG + Intergenic
1181082697 22:20425252-20425274 GGGCACCGCGCGGCTAGCGGAGG - Exonic
1183539402 22:38421045-38421067 GGGCATGGGGCCGAGAGCACTGG - Intergenic
1185204737 22:49531336-49531358 GGGCACCGCGGAGGAAGCGCAGG + Intronic
950530231 3:13548933-13548955 GGGCTCCGCAGCGAGCGCGCCGG + Intergenic
952418942 3:33114249-33114271 GAGCACTGGGCCGAGAGCGTGGG + Exonic
952816559 3:37452318-37452340 GAGCAGGGCGCCGAGCGCGCGGG - Exonic
961775067 3:129278781-129278803 GGGCCTGGCGCCGGGAGCGCGGG + Intergenic
967858346 3:194134545-194134567 GGGCCCCGCGGGGAGAGGGCGGG + Intergenic
968550733 4:1222409-1222431 GGGGCCCGCGCCGAGAGCGAGGG + Intronic
969239232 4:5888323-5888345 GGGAGCGGGGCCGAGAGCGCCGG - Intronic
969529681 4:7723787-7723809 CGGCACCGCTACGAGAGCCCCGG + Exonic
969611880 4:8232145-8232167 GGGCACCGAGCGGTGAGGGCTGG + Exonic
969627479 4:8314929-8314951 GGGCACCGAGGGGAGAGGGCAGG + Intergenic
973531792 4:51843184-51843206 GGGGACCGCGAGGCGAGCGCGGG + Exonic
995784688 5:115816038-115816060 GGGCTCCGCGGCCACAGCGCAGG - Intronic
997207315 5:132057318-132057340 GGGCTCCTCGCAGAGAGCTCAGG - Intergenic
1003507324 6:6750811-6750833 GGACACCGTGGCGAGAGCTCCGG + Intergenic
1003645442 6:7910316-7910338 GGGCGCGGGGCCGGGAGCGCGGG - Intronic
1019049580 6:169172689-169172711 GGCCACGGGGCCGAGAGGGCAGG + Intergenic
1019337860 7:493815-493837 AGGCACCGCGCCGAGGTCGTGGG + Intergenic
1019438067 7:1031904-1031926 GGGGAACGGGCCGAGAGTGCGGG + Intronic
1021231040 7:18086692-18086714 AGGACCCGCGGCGAGAGCGCGGG - Intergenic
1029733326 7:102451848-102451870 GGGCTCCGCCCCGAGAGCGCAGG + Exonic
1033288557 7:140062496-140062518 AGGCGCCGCGCCGGGAGCGACGG - Intronic
1034964316 7:155382304-155382326 GGGCACCGCGCGGTGAGTGTCGG + Exonic
1035300486 7:157894197-157894219 GGGCACAAAGCCGAGAGCACAGG + Intronic
1037768874 8:21787603-21787625 GGACATCGCGCGGGGAGCGCTGG - Intronic
1045516506 8:102864501-102864523 GGGCCCCGCAGCGTGAGCGCAGG - Exonic
1050512909 9:6413430-6413452 GGGCGCGGCGCCCAGAGCTCAGG + Exonic
1061565484 9:131436571-131436593 AGGCACCGCACAGAGTGCGCTGG - Intronic
1061954220 9:133953283-133953305 GGGCACAGCGCCAAGGGCACAGG - Intronic
1192533666 X:71910887-71910909 GGGTTCCTCGCCTAGAGCGCCGG - Intergenic
1195923194 X:110002707-110002729 GCGCCCGGCGCGGAGAGCGCGGG + Intronic
1199606144 X:149581189-149581211 GCGCACCGAGACAAGAGCGCGGG + Intergenic
1199632977 X:149788179-149788201 GCGCACCGAGACAAGAGCGCGGG - Intergenic
1202115795 Y:21468084-21468106 GGGAACCGTGCCAAGATCGCCGG - Intergenic