ID: 1123716711

View in Genome Browser
Species Human (GRCh38)
Location 15:23039216-23039238
Sequence ACCGCGCCGAGAGCGCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 50}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716709_1123716711 -6 Left 1123716709 15:23039199-23039221 CCTGTGGTGCGCAGGGCACCGCG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716700_1123716711 28 Left 1123716700 15:23039165-23039187 CCGTGACGATCAGGACGCGTCCC 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716705_1123716711 7 Left 1123716705 15:23039186-23039208 CCGGGTAACACGCCCTGTGGTGC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716698_1123716711 30 Left 1123716698 15:23039163-23039185 CCCCGTGACGATCAGGACGCGTC 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716708_1123716711 -5 Left 1123716708 15:23039198-23039220 CCCTGTGGTGCGCAGGGCACCGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716704_1123716711 8 Left 1123716704 15:23039185-23039207 CCCGGGTAACACGCCCTGTGGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50
1123716699_1123716711 29 Left 1123716699 15:23039164-23039186 CCCGTGACGATCAGGACGCGTCC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716711 Original CRISPR ACCGCGCCGAGAGCGCTGGC CGG Intronic
900121663 1:1050907-1050929 ACAGCTCCGTGAGCGCCGGCAGG - Intronic
902823294 1:18956389-18956411 GCCGCGCCGGGAGCCCTGCCCGG - Exonic
905670920 1:39789303-39789325 GCCGCGCAGCGAGGGCTGGCGGG - Intergenic
906640220 1:47437226-47437248 TCCGCGCGGAGAGGGGTGGCGGG + Exonic
916667059 1:166975811-166975833 ACCCGGGCGAGAACGCTGGCTGG + Intronic
922730842 1:227948093-227948115 CCCGCGCCGGGAGCGGCGGCCGG - Intergenic
924414991 1:243849874-243849896 ACCGCGCCGGGGGCGTGGGCGGG - Intronic
1075645448 10:124093272-124093294 ACCGCGCCGGGAGCGCCGCGGGG + Intronic
1077164958 11:1130798-1130820 AGGGCGCCGTGAGGGCTGGCAGG - Intergenic
1085666363 11:78418129-78418151 ACCGCGCCCCTGGCGCTGGCGGG + Intronic
1091762454 12:3096042-3096064 GCCGCGCCGGGAGCGCCGCCCGG - Intronic
1113948849 13:114060077-114060099 ACGGCGCGGAGAGCGCAGGAGGG + Intronic
1122811780 14:104292780-104292802 GCCGCCCCGAGAGCTCTGCCGGG - Intergenic
1123716711 15:23039216-23039238 ACCGCGCCGAGAGCGCTGGCCGG + Intronic
1124249887 15:28099576-28099598 TCCCCGCGGAGAGCGCTGTCGGG - Intergenic
1132469040 16:91648-91670 ACCGCACTGAGAGCTCTGTCAGG + Intronic
1133100479 16:3476243-3476265 ACCTCGCTGAGCGCGCTGGATGG - Exonic
1133286927 16:4694788-4694810 ACTGCTCCGAGGGAGCTGGCTGG + Intronic
1134858756 16:17542118-17542140 ATCGTGCCGAGAAAGCTGGCTGG + Intergenic
1147732755 17:42614213-42614235 ACTGTGCCCTGAGCGCTGGCCGG + Intronic
1147740011 17:42666040-42666062 ACTGTGCCCTGAGCGCTGGCCGG + Intronic
1152714345 17:81891363-81891385 GCCGCGCCGCGGGCGATGGCCGG + Exonic
1153805494 18:8705941-8705963 ACTGCGCCGAGAGAGGCGGCCGG - Intronic
1156171687 18:34493796-34493818 AGCGGGCGGAGAGCGCCGGCGGG + Intronic
1160500889 18:79400658-79400680 ACCCCGCCGCGAGCGCTCGGAGG - Intronic
1166735106 19:45079383-45079405 ACCGCGCCTGCAGCGCCGGCTGG + Intronic
927956649 2:27211930-27211952 GCCCGGCCGAGAGCCCTGGCCGG + Intronic
1169065766 20:2693388-2693410 CCCGCGGCCTGAGCGCTGGCGGG - Intronic
1172633945 20:36396812-36396834 ACCGCCCTGAGAGGGCAGGCAGG - Intronic
1176022236 20:62967728-62967750 ACAGGGCCGAGCCCGCTGGCAGG - Exonic
1181177474 22:21045915-21045937 CCCGCGCCCAGAGCGCGGCCCGG - Intergenic
1184106153 22:42368608-42368630 AGCGCGCTGAGCGGGCTGGCGGG - Intergenic
949414239 3:3799298-3799320 GCCGCGCCGAGGGCGGGGGCGGG + Intronic
954316247 3:49803316-49803338 GCCGCGCGGAGAGGGCTGGGAGG - Exonic
958814560 3:98901520-98901542 CCCGCGCCGAGACCCCAGGCCGG + Exonic
968668822 4:1836854-1836876 CCCGAGCCCAGAGTGCTGGCCGG - Intronic
971244175 4:24913219-24913241 CCCGCGCGGAGAGCGCTGAGGGG - Intronic
976213766 4:82696318-82696340 CCCGTGACGAGAGCGCTGGCTGG + Intronic
983249406 4:165327599-165327621 ACCGCGCCGAGAAGGCGGGGCGG + Intergenic
985651968 5:1111651-1111673 ACCGTACCGGGAGCCCTGGCAGG + Intronic
988470417 5:31532298-31532320 TCCGCCCGGAGAGAGCTGGCCGG + Exonic
998143373 5:139711971-139711993 ACGGCGCCCAGAGCGCTGGCGGG - Intergenic
1010032895 6:71288837-71288859 GCCGCGGCGAGGGCGCTGGGCGG - Exonic
1016658056 6:146543689-146543711 CCCGGGCCGCGAGCACTGGCGGG + Exonic
1019285112 7:219456-219478 ACCCCGCCGACAGCCCTGGCTGG - Intronic
1033288555 7:140062492-140062514 GCCGCGCCGGGAGCGACGGCGGG - Intronic
1036768739 8:11564759-11564781 CCCGCGCCGGGAGCTCTGGGCGG + Intergenic
1038540424 8:28386101-28386123 GCCGCGCCGGGAGGGCGGGCAGG - Intronic
1057043500 9:91865256-91865278 ACCGAGTGAAGAGCGCTGGCTGG - Intronic
1058799353 9:108530244-108530266 CCCGGGCCGGCAGCGCTGGCCGG - Intergenic
1060982694 9:127802890-127802912 CCCGGGCCTAGAGCGCTGCCGGG + Exonic
1061873280 9:133531816-133531838 ACCTAGCCGATAGGGCTGGCCGG - Intergenic
1062615855 9:137395365-137395387 GCCGGGCCGAGGACGCTGGCAGG + Exonic
1196765326 X:119236923-119236945 CCCGCGCTGACAGCGCTGGGAGG + Intronic