ID: 1123718066

View in Genome Browser
Species Human (GRCh38)
Location 15:23044055-23044077
Sequence TCCCCCCAGCACCCCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718066_1123718075 12 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718075 15:23044090-23044112 ACCTGGCCAGAGGTGCTGGGGGG No data
1123718066_1123718073 10 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718073 15:23044088-23044110 TCACCTGGCCAGAGGTGCTGGGG No data
1123718066_1123718072 9 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718072 15:23044087-23044109 CTCACCTGGCCAGAGGTGCTGGG No data
1123718066_1123718074 11 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718074 15:23044089-23044111 CACCTGGCCAGAGGTGCTGGGGG No data
1123718066_1123718068 -5 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data
1123718066_1123718071 8 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718071 15:23044086-23044108 CCTCACCTGGCCAGAGGTGCTGG No data
1123718066_1123718069 2 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718069 15:23044080-23044102 TCATAACCTCACCTGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718066 Original CRISPR TCCCCCCAGCACCCCTGGCC AGG (reversed) Intergenic
No off target data available for this crispr