ID: 1123718068

View in Genome Browser
Species Human (GRCh38)
Location 15:23044073-23044095
Sequence GGGGACATCATAACCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718053_1123718068 27 Left 1123718053 15:23044023-23044045 CCAGAGGTGCTGGGGGGGATTTC No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data
1123718066_1123718068 -5 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data
1123718060_1123718068 -1 Left 1123718060 15:23044051-23044073 CCCACCTGGCCAGGGGTGCTGGG No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data
1123718062_1123718068 -2 Left 1123718062 15:23044052-23044074 CCACCTGGCCAGGGGTGCTGGGG No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data
1123718058_1123718068 0 Left 1123718058 15:23044050-23044072 CCCCACCTGGCCAGGGGTGCTGG No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data
1123718067_1123718068 -10 Left 1123718067 15:23044060-23044082 CCAGGGGTGCTGGGGGGACATCA No data
Right 1123718068 15:23044073-23044095 GGGGACATCATAACCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718068 Original CRISPR GGGGACATCATAACCTCACC TGG Intergenic
No off target data available for this crispr