ID: 1123718075

View in Genome Browser
Species Human (GRCh38)
Location 15:23044090-23044112
Sequence ACCTGGCCAGAGGTGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718060_1123718075 16 Left 1123718060 15:23044051-23044073 CCCACCTGGCCAGGGGTGCTGGG No data
Right 1123718075 15:23044090-23044112 ACCTGGCCAGAGGTGCTGGGGGG No data
1123718067_1123718075 7 Left 1123718067 15:23044060-23044082 CCAGGGGTGCTGGGGGGACATCA No data
Right 1123718075 15:23044090-23044112 ACCTGGCCAGAGGTGCTGGGGGG No data
1123718066_1123718075 12 Left 1123718066 15:23044055-23044077 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718075 15:23044090-23044112 ACCTGGCCAGAGGTGCTGGGGGG No data
1123718062_1123718075 15 Left 1123718062 15:23044052-23044074 CCACCTGGCCAGGGGTGCTGGGG No data
Right 1123718075 15:23044090-23044112 ACCTGGCCAGAGGTGCTGGGGGG No data
1123718058_1123718075 17 Left 1123718058 15:23044050-23044072 CCCCACCTGGCCAGGGGTGCTGG No data
Right 1123718075 15:23044090-23044112 ACCTGGCCAGAGGTGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718075 Original CRISPR ACCTGGCCAGAGGTGCTGGG GGG Intergenic
No off target data available for this crispr