ID: 1123718302

View in Genome Browser
Species Human (GRCh38)
Location 15:23044869-23044891
Sequence GTCCCCCGGCACCTCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718302_1123718308 11 Left 1123718302 15:23044869-23044891 CCTGGCCAGAGGTGCCGGGGGAC No data
Right 1123718308 15:23044903-23044925 ACCTGGCCAGAGGTGCCCAGAGG No data
1123718302_1123718306 1 Left 1123718302 15:23044869-23044891 CCTGGCCAGAGGTGCCGGGGGAC No data
Right 1123718306 15:23044893-23044915 ACATAACCACACCTGGCCAGAGG No data
1123718302_1123718305 -6 Left 1123718302 15:23044869-23044891 CCTGGCCAGAGGTGCCGGGGGAC No data
Right 1123718305 15:23044886-23044908 GGGGACAACATAACCACACCTGG No data
1123718302_1123718313 30 Left 1123718302 15:23044869-23044891 CCTGGCCAGAGGTGCCGGGGGAC No data
Right 1123718313 15:23044922-23044944 GAGGACTTCATAACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718302 Original CRISPR GTCCCCCGGCACCTCTGGCC AGG (reversed) Intergenic
No off target data available for this crispr