ID: 1123718844

View in Genome Browser
Species Human (GRCh38)
Location 15:23046783-23046805
Sequence GCCCCTCGGCACCTCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718844_1123718859 18 Left 1123718844 15:23046783-23046805 CCTGGCCGGAGGTGCCGAGGGGC No data
Right 1123718859 15:23046824-23046846 CCACCTGGCCAGAGGTGCTGGGG No data
1123718844_1123718853 10 Left 1123718844 15:23046783-23046805 CCTGGCCGGAGGTGCCGAGGGGC No data
Right 1123718853 15:23046816-23046838 TCATAACCCCACCTGGCCAGAGG No data
1123718844_1123718855 16 Left 1123718844 15:23046783-23046805 CCTGGCCGGAGGTGCCGAGGGGC No data
Right 1123718855 15:23046822-23046844 CCCCACCTGGCCAGAGGTGCTGG No data
1123718844_1123718857 17 Left 1123718844 15:23046783-23046805 CCTGGCCGGAGGTGCCGAGGGGC No data
Right 1123718857 15:23046823-23046845 CCCACCTGGCCAGAGGTGCTGGG No data
1123718844_1123718860 19 Left 1123718844 15:23046783-23046805 CCTGGCCGGAGGTGCCGAGGGGC No data
Right 1123718860 15:23046825-23046847 CACCTGGCCAGAGGTGCTGGGGG No data
1123718844_1123718852 3 Left 1123718844 15:23046783-23046805 CCTGGCCGGAGGTGCCGAGGGGC No data
Right 1123718852 15:23046809-23046831 GGGAACTTCATAACCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718844 Original CRISPR GCCCCTCGGCACCTCCGGCC AGG (reversed) Intergenic
No off target data available for this crispr