ID: 1123718944

View in Genome Browser
Species Human (GRCh38)
Location 15:23047120-23047142
Sequence TCCCCCCAGCACCCCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718944_1123718951 10 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718951 15:23047153-23047175 TCACCTGGCCAGAGGTGCTGGGG No data
1123718944_1123718952 11 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718952 15:23047154-23047176 CACCTGGCCAGAGGTGCTGGGGG No data
1123718944_1123718946 -5 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718946 15:23047138-23047160 GGGGACATCATAACCTCACCTGG No data
1123718944_1123718949 8 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718949 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data
1123718944_1123718947 2 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718947 15:23047145-23047167 TCATAACCTCACCTGGCCAGAGG No data
1123718944_1123718950 9 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718950 15:23047152-23047174 CTCACCTGGCCAGAGGTGCTGGG No data
1123718944_1123718956 30 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718956 15:23047173-23047195 GGGGGTATCATAATCTGACCTGG No data
1123718944_1123718953 12 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718953 15:23047155-23047177 ACCTGGCCAGAGGTGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718944 Original CRISPR TCCCCCCAGCACCCCTGGCC AGG (reversed) Intergenic
No off target data available for this crispr