ID: 1123718949

View in Genome Browser
Species Human (GRCh38)
Location 15:23047151-23047173
Sequence CCTCACCTGGCCAGAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718938_1123718949 12 Left 1123718938 15:23047116-23047138 CCCACCTGGCCAGGGGTGCTGGG No data
Right 1123718949 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data
1123718945_1123718949 3 Left 1123718945 15:23047125-23047147 CCAGGGGTGCTGGGGGGACATCA No data
Right 1123718949 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data
1123718944_1123718949 8 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718949 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data
1123718936_1123718949 13 Left 1123718936 15:23047115-23047137 CCCCACCTGGCCAGGGGTGCTGG No data
Right 1123718949 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data
1123718940_1123718949 11 Left 1123718940 15:23047117-23047139 CCACCTGGCCAGGGGTGCTGGGG No data
Right 1123718949 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718949 Original CRISPR CCTCACCTGGCCAGAGGTGC TGG Intergenic
No off target data available for this crispr