ID: 1123718956

View in Genome Browser
Species Human (GRCh38)
Location 15:23047173-23047195
Sequence GGGGGTATCATAATCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123718948_1123718956 -1 Left 1123718948 15:23047151-23047173 CCTCACCTGGCCAGAGGTGCTGG No data
Right 1123718956 15:23047173-23047195 GGGGGTATCATAATCTGACCTGG No data
1123718954_1123718956 -6 Left 1123718954 15:23047156-23047178 CCTGGCCAGAGGTGCTGGGGGGT No data
Right 1123718956 15:23047173-23047195 GGGGGTATCATAATCTGACCTGG No data
1123718944_1123718956 30 Left 1123718944 15:23047120-23047142 CCTGGCCAGGGGTGCTGGGGGGA No data
Right 1123718956 15:23047173-23047195 GGGGGTATCATAATCTGACCTGG No data
1123718945_1123718956 25 Left 1123718945 15:23047125-23047147 CCAGGGGTGCTGGGGGGACATCA No data
Right 1123718956 15:23047173-23047195 GGGGGTATCATAATCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123718956 Original CRISPR GGGGGTATCATAATCTGACC TGG Intergenic
No off target data available for this crispr