ID: 1123719049

View in Genome Browser
Species Human (GRCh38)
Location 15:23047489-23047511
Sequence GCCTCCCAGCACCTCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123719049_1123719056 3 Left 1123719049 15:23047489-23047511 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719056 15:23047515-23047537 GGGAAATTCATAACCCCACCTGG No data
1123719049_1123719062 19 Left 1123719049 15:23047489-23047511 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719062 15:23047531-23047553 CACCTGGCCAGAGGTGCTGGTGG No data
1123719049_1123719057 10 Left 1123719049 15:23047489-23047511 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719057 15:23047522-23047544 TCATAACCCCACCTGGCCAGAGG No data
1123719049_1123719059 16 Left 1123719049 15:23047489-23047511 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719059 15:23047528-23047550 CCCCACCTGGCCAGAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123719049 Original CRISPR GCCTCCCAGCACCTCCGGCC AGG (reversed) Intergenic
No off target data available for this crispr