ID: 1123719340

View in Genome Browser
Species Human (GRCh38)
Location 15:23048494-23048516
Sequence GCCTCCCAGCACCTCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123719340_1123719350 16 Left 1123719340 15:23048494-23048516 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719350 15:23048533-23048555 CCCCACCTGGCCAGAGGTGCTGG No data
1123719340_1123719347 3 Left 1123719340 15:23048494-23048516 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719347 15:23048520-23048542 GGGAACTTCATAACCCCACCTGG No data
1123719340_1123719353 19 Left 1123719340 15:23048494-23048516 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719353 15:23048536-23048558 CACCTGGCCAGAGGTGCTGGTGG No data
1123719340_1123719348 10 Left 1123719340 15:23048494-23048516 CCTGGCCGGAGGTGCTGGGAGGC No data
Right 1123719348 15:23048527-23048549 TCATAACCCCACCTGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123719340 Original CRISPR GCCTCCCAGCACCTCCGGCC AGG (reversed) Intergenic
No off target data available for this crispr