ID: 1123721260

View in Genome Browser
Species Human (GRCh38)
Location 15:23063840-23063862
Sequence TAAAATCTCCCAGAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721260_1123721265 12 Left 1123721260 15:23063840-23063862 CCATGCTCCTCTGGGAGATTTTA No data
Right 1123721265 15:23063875-23063897 CTGTTGGACCTGGACAGAGCAGG No data
1123721260_1123721262 -4 Left 1123721260 15:23063840-23063862 CCATGCTCCTCTGGGAGATTTTA No data
Right 1123721262 15:23063859-23063881 TTTAGCCTTAGCATGACTGTTGG No data
1123721260_1123721264 2 Left 1123721260 15:23063840-23063862 CCATGCTCCTCTGGGAGATTTTA No data
Right 1123721264 15:23063865-23063887 CTTAGCATGACTGTTGGACCTGG No data
1123721260_1123721268 28 Left 1123721260 15:23063840-23063862 CCATGCTCCTCTGGGAGATTTTA No data
Right 1123721268 15:23063891-23063913 GAGCAGGATGGTCTTGCCCTTGG No data
1123721260_1123721266 16 Left 1123721260 15:23063840-23063862 CCATGCTCCTCTGGGAGATTTTA No data
Right 1123721266 15:23063879-23063901 TGGACCTGGACAGAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721260 Original CRISPR TAAAATCTCCCAGAGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr