ID: 1123721388

View in Genome Browser
Species Human (GRCh38)
Location 15:23064636-23064658
Sequence ACCCCCAACACTCCAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721388_1123721396 13 Left 1123721388 15:23064636-23064658 CCCCCCATTGGAGTGTTGGGGGT No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721388_1123721394 -1 Left 1123721388 15:23064636-23064658 CCCCCCATTGGAGTGTTGGGGGT No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721388 Original CRISPR ACCCCCAACACTCCAATGGG GGG (reversed) Intergenic
No off target data available for this crispr