ID: 1123721390

View in Genome Browser
Species Human (GRCh38)
Location 15:23064638-23064660
Sequence TGACCCCCAACACTCCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721390_1123721396 11 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721390_1123721403 30 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721403 15:23064691-23064713 CCGGCAAATTCCTAAATCAAGGG No data
1123721390_1123721401 29 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721390_1123721394 -3 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721390 Original CRISPR TGACCCCCAACACTCCAATG GGG (reversed) Intergenic