ID: 1123721391

View in Genome Browser
Species Human (GRCh38)
Location 15:23064639-23064661
Sequence CTGACCCCCAACACTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721391_1123721396 10 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721391_1123721394 -4 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721391_1123721403 29 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721403 15:23064691-23064713 CCGGCAAATTCCTAAATCAAGGG No data
1123721391_1123721401 28 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721391_1123721404 30 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721404 15:23064692-23064714 CGGCAAATTCCTAAATCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721391 Original CRISPR CTGACCCCCAACACTCCAAT GGG (reversed) Intergenic
No off target data available for this crispr