ID: 1123721394

View in Genome Browser
Species Human (GRCh38)
Location 15:23064658-23064680
Sequence TCAGTGGACCAGAAACACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721382_1123721394 22 Left 1123721382 15:23064613-23064635 CCAATGAAACACTTTGGCTGACA No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721391_1123721394 -4 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721380_1123721394 24 Left 1123721380 15:23064611-23064633 CCCCAATGAAACACTTTGGCTGA No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721389_1123721394 -2 Left 1123721389 15:23064637-23064659 CCCCCATTGGAGTGTTGGGGGTC No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721390_1123721394 -3 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721388_1123721394 -1 Left 1123721388 15:23064636-23064658 CCCCCCATTGGAGTGTTGGGGGT No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721392_1123721394 -5 Left 1123721392 15:23064640-23064662 CCATTGGAGTGTTGGGGGTCAGT No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721378_1123721394 30 Left 1123721378 15:23064605-23064627 CCATTGCCCCAATGAAACACTTT No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data
1123721381_1123721394 23 Left 1123721381 15:23064612-23064634 CCCAATGAAACACTTTGGCTGAC No data
Right 1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721394 Original CRISPR TCAGTGGACCAGAAACACCT TGG Intergenic
No off target data available for this crispr