ID: 1123721396

View in Genome Browser
Species Human (GRCh38)
Location 15:23064672-23064694
Sequence ACACCTTGGCCCCTCTAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721392_1123721396 9 Left 1123721392 15:23064640-23064662 CCATTGGAGTGTTGGGGGTCAGT No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721390_1123721396 11 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721388_1123721396 13 Left 1123721388 15:23064636-23064658 CCCCCCATTGGAGTGTTGGGGGT No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721391_1123721396 10 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data
1123721389_1123721396 12 Left 1123721389 15:23064637-23064659 CCCCCATTGGAGTGTTGGGGGTC No data
Right 1123721396 15:23064672-23064694 ACACCTTGGCCCCTCTAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721396 Original CRISPR ACACCTTGGCCCCTCTAGTC CGG Intergenic
No off target data available for this crispr