ID: 1123721401

View in Genome Browser
Species Human (GRCh38)
Location 15:23064690-23064712
Sequence TCCGGCAAATTCCTAAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721392_1123721401 27 Left 1123721392 15:23064640-23064662 CCATTGGAGTGTTGGGGGTCAGT No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721395_1123721401 1 Left 1123721395 15:23064666-23064688 CCAGAAACACCTTGGCCCCTCTA No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721391_1123721401 28 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721390_1123721401 29 Left 1123721390 15:23064638-23064660 CCCCATTGGAGTGTTGGGGGTCA No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721397_1123721401 -8 Left 1123721397 15:23064675-23064697 CCTTGGCCCCTCTAGTCCGGCAA No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data
1123721389_1123721401 30 Left 1123721389 15:23064637-23064659 CCCCCATTGGAGTGTTGGGGGTC No data
Right 1123721401 15:23064690-23064712 TCCGGCAAATTCCTAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721401 Original CRISPR TCCGGCAAATTCCTAAATCA AGG Intergenic
No off target data available for this crispr