ID: 1123721404

View in Genome Browser
Species Human (GRCh38)
Location 15:23064692-23064714
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123721395_1123721404 3 Left 1123721395 15:23064666-23064688 CCAGAAACACCTTGGCCCCTCTA No data
Right 1123721404 15:23064692-23064714 CGGCAAATTCCTAAATCAAGGGG No data
1123721397_1123721404 -6 Left 1123721397 15:23064675-23064697 CCTTGGCCCCTCTAGTCCGGCAA No data
Right 1123721404 15:23064692-23064714 CGGCAAATTCCTAAATCAAGGGG No data
1123721391_1123721404 30 Left 1123721391 15:23064639-23064661 CCCATTGGAGTGTTGGGGGTCAG No data
Right 1123721404 15:23064692-23064714 CGGCAAATTCCTAAATCAAGGGG No data
1123721392_1123721404 29 Left 1123721392 15:23064640-23064662 CCATTGGAGTGTTGGGGGTCAGT No data
Right 1123721404 15:23064692-23064714 CGGCAAATTCCTAAATCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123721404 Original CRISPR CGGCAAATTCCTAAATCAAG GGG Intergenic
No off target data available for this crispr