ID: 1123722573 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:23072541-23072563 |
| Sequence | CATTGTACACACAAGGAGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123722568_1123722573 | 5 | Left | 1123722568 | 15:23072513-23072535 | CCATTAAGGCTGGTACTGTTATT | 0: 2 1: 0 2: 7 3: 46 4: 446 |
||
| Right | 1123722573 | 15:23072541-23072563 | CATTGTACACACAAGGAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123722573 | Original CRISPR | CATTGTACACACAAGGAGAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||