ID: 1123722573

View in Genome Browser
Species Human (GRCh38)
Location 15:23072541-23072563
Sequence CATTGTACACACAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123722568_1123722573 5 Left 1123722568 15:23072513-23072535 CCATTAAGGCTGGTACTGTTATT 0: 2
1: 0
2: 7
3: 46
4: 446
Right 1123722573 15:23072541-23072563 CATTGTACACACAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123722573 Original CRISPR CATTGTACACACAAGGAGAC AGG Intergenic
No off target data available for this crispr