ID: 1123724294

View in Genome Browser
Species Human (GRCh38)
Location 15:23086754-23086776
Sequence CTGGGAGTTACACACTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123724288_1123724294 10 Left 1123724288 15:23086721-23086743 CCCTCCTAAGCTCTGGTAATTTA 0: 2
1: 0
2: 0
3: 10
4: 240
Right 1123724294 15:23086754-23086776 CTGGGAGTTACACACTTTTATGG No data
1123724290_1123724294 6 Left 1123724290 15:23086725-23086747 CCTAAGCTCTGGTAATTTAATAT 0: 2
1: 2
2: 3
3: 31
4: 275
Right 1123724294 15:23086754-23086776 CTGGGAGTTACACACTTTTATGG No data
1123724289_1123724294 9 Left 1123724289 15:23086722-23086744 CCTCCTAAGCTCTGGTAATTTAA 0: 2
1: 0
2: 2
3: 27
4: 195
Right 1123724294 15:23086754-23086776 CTGGGAGTTACACACTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123724294 Original CRISPR CTGGGAGTTACACACTTTTA TGG Intergenic
No off target data available for this crispr