ID: 1123724520

View in Genome Browser
Species Human (GRCh38)
Location 15:23088698-23088720
Sequence ATCCAGCCGGGTCTCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123724520_1123724524 -7 Left 1123724520 15:23088698-23088720 CCAACATGGAGACCCGGCTGGAT No data
Right 1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123724520 Original CRISPR ATCCAGCCGGGTCTCCATGT TGG (reversed) Intergenic
No off target data available for this crispr