ID: 1123724524

View in Genome Browser
Species Human (GRCh38)
Location 15:23088714-23088736
Sequence GCTGGATACCATGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123724513_1123724524 20 Left 1123724513 15:23088671-23088693 CCCAGCTGATGGAGAGGACCCAG 0: 1
1: 0
2: 3
3: 22
4: 230
Right 1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 210
1123724517_1123724524 1 Left 1123724517 15:23088690-23088712 CCAGTCATCCAACATGGAGACCC No data
Right 1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 210
1123724520_1123724524 -7 Left 1123724520 15:23088698-23088720 CCAACATGGAGACCCGGCTGGAT No data
Right 1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 210
1123724516_1123724524 2 Left 1123724516 15:23088689-23088711 CCCAGTCATCCAACATGGAGACC No data
Right 1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 210
1123724514_1123724524 19 Left 1123724514 15:23088672-23088694 CCAGCTGATGGAGAGGACCCAGT No data
Right 1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123724524 Original CRISPR GCTGGATACCATGAAGGTGC TGG Intergenic
900753764 1:4418742-4418764 GCTGATCACCATGAATGTGCTGG + Intergenic
905655490 1:39683930-39683952 GCTGGAGATCATCGAGGTGCGGG - Exonic
907981640 1:59487466-59487488 GCCAGGTACCATGCAGGTGCTGG - Intronic
908145891 1:61242794-61242816 GCTGGTTGTCATGAAGGTACTGG + Intronic
910001677 1:82349753-82349775 CCTAGATACAATGAGGGTGCAGG + Intergenic
911275073 1:95850392-95850414 CCTAGATACAATGAAGGTACAGG - Intergenic
912279377 1:108297263-108297285 CCTGGATACAATGGAGGTACAGG + Intergenic
912288849 1:108397094-108397116 CCTGGATACAATGGAGGTACAGG - Intronic
913297447 1:117335661-117335683 GGTGGAAACCATGGAGGTGAGGG + Intergenic
913695974 1:121326019-121326041 GCTGGAAACCATGGAGGAGATGG - Intronic
914141590 1:144954040-144954062 GCTGGAAACCATGGAGGAGATGG + Intronic
914230790 1:145763793-145763815 TCTGGAAAACATGAATGTGCTGG + Intronic
915633597 1:157171255-157171277 GCTTGATACCTGGAAGGTGCTGG + Intergenic
915636937 1:157194146-157194168 GCTTGATACTTGGAAGGTGCTGG + Intergenic
916502211 1:165396691-165396713 GCTGTATACCCTGAAGGGGTAGG + Intergenic
920118616 1:203638809-203638831 TCTAGAAACCATAAAGGTGCTGG + Intronic
920483300 1:206344387-206344409 GCTGGAAACCATGGAGGAGATGG - Intronic
920734975 1:208525446-208525468 TCTGGAGAGAATGAAGGTGCAGG + Intergenic
921775758 1:219097609-219097631 CCTGGATACAATGAGGGTACAGG - Intergenic
922785861 1:228281958-228281980 GCTGAAGACAATGGAGGTGCTGG + Exonic
923663953 1:235982307-235982329 GCTGGAGACTATGAGGGTGGGGG + Intronic
924177811 1:241410716-241410738 ACAGGATACCAGGAAGGTGAGGG + Intergenic
1063372546 10:5531290-5531312 ACTGGACCCCATGCAGGTGCTGG + Intergenic
1064623705 10:17241011-17241033 TCTGAATACCATGACGTTGCAGG - Intergenic
1065576028 10:27119321-27119343 AATGGTTACCATGAAGGAGCTGG - Exonic
1065666948 10:28073050-28073072 GCTGGAGCACATGAAGGTCCTGG - Intronic
1066662648 10:37752015-37752037 GCTGGAGACCATGGGTGTGCAGG + Intergenic
1068471394 10:57468901-57468923 ACTGGATACAATCAAGGTGTTGG + Intergenic
1068985898 10:63107379-63107401 GCTGGCTACTACGCAGGTGCTGG + Intergenic
1069175664 10:65285914-65285936 CCTGGATACAATGAAGGTATAGG + Intergenic
1070115052 10:73520470-73520492 GCTGCATACTATGAAGGTAGGGG + Intronic
1070620446 10:78005654-78005676 GCTGGAAATGATGAATGTGCTGG + Intronic
1074829231 10:117237027-117237049 GCTGGATACAGGGAAGGTGTAGG - Intergenic
1076343553 10:129765835-129765857 TCTGGTTTCCATGTAGGTGCTGG - Intronic
1076759995 10:132599251-132599273 CCTGGATACAATGGAGGTACAGG + Intronic
1077797575 11:5508267-5508289 GGTGGAGACCAAGATGGTGCAGG - Exonic
1079049897 11:17145032-17145054 CCTGGATACAATGGAGGTACAGG - Intronic
1083089605 11:60186121-60186143 GCTGAACACCATGAAGGAACTGG + Intergenic
1084610518 11:70199653-70199675 GATGGAAACCGGGAAGGTGCGGG - Intergenic
1084929944 11:72547088-72547110 GCTGGATACCATAAAGCTCGGGG + Intergenic
1085017196 11:73182555-73182577 CCTGGATACCTTTAAGTTGCAGG + Intergenic
1086333987 11:85781628-85781650 CCTGGATACAATGAGGGTACAGG + Intronic
1086972021 11:93091807-93091829 ACTTGATACCATGAAGCAGCTGG + Intergenic
1088149169 11:106723494-106723516 GCTGTGTACCAGGAAGGTTCTGG - Intronic
1088211252 11:107459105-107459127 GCTGGATAAAATCAAGGTGTTGG + Intergenic
1089202002 11:116730204-116730226 GCTGGACACCATAGAGGAGCAGG - Intergenic
1092011362 12:5115422-5115444 CCTGGAGACCATGGAGATGCAGG + Intergenic
1093627951 12:21372488-21372510 GCTGAATCCCATGAAGCTTCAGG - Intronic
1094075541 12:26469431-26469453 GCAGGATACCATGGGGGTGGGGG - Intronic
1096081684 12:48837517-48837539 ACTGCATGCCATTAAGGTGCAGG - Exonic
1099802563 12:87474930-87474952 CCTAGATACCATGCAGGTACAGG - Intergenic
1102082472 12:110109619-110109641 GCTGGAGAGCAGGAAGGGGCAGG + Intergenic
1102399346 12:112615118-112615140 GCCAGATCCCATCAAGGTGCTGG - Intronic
1108099959 13:46944399-46944421 CCTAGATACAATGAAGGTACAGG + Intergenic
1110496418 13:76173671-76173693 CCTAGATACAATGCAGGTGCAGG + Intergenic
1111687143 13:91516291-91516313 CCTGGATACAATGAGGGTACAGG + Intronic
1114201360 14:20523985-20524007 GCTGGATTCCATTCTGGTGCTGG + Intergenic
1115364637 14:32544136-32544158 GCTGGATTCCATGTGGCTGCTGG - Intronic
1120734835 14:88041348-88041370 GCTAGAGATCATGAAGGTTCGGG - Intergenic
1121171833 14:91861047-91861069 GCTGGATACCATAATGGAGTGGG + Intronic
1123205113 14:106704814-106704836 TCAGGACACCAGGAAGGTGCTGG - Intergenic
1123724524 15:23088714-23088736 GCTGGATACCATGAAGGTGCTGG + Intergenic
1125192071 15:37005184-37005206 GCTGGATAACATCATGGTGAGGG - Intronic
1127187041 15:56490849-56490871 GCTGGGTACCATGGAGGAGACGG - Intergenic
1128707118 15:69844381-69844403 GCTGGTTTCCATGAAGGTTTGGG - Intergenic
1129113015 15:73349130-73349152 GCTGGAGACCAGGAAGGAGGTGG - Intronic
1130115614 15:81002132-81002154 GGTGGATGGCATGATGGTGCGGG + Exonic
1130712264 15:86294828-86294850 GATGGATACCCTAAAAGTGCTGG - Intronic
1132470902 16:102417-102439 GCAGGACACAAGGAAGGTGCCGG - Intronic
1132763598 16:1523511-1523533 GCTGGCTGCCAGGAAGGTACGGG - Exonic
1133050746 16:3115936-3115958 GCTGAGTACCATGCAGGGGCCGG - Intronic
1134453716 16:14379041-14379063 GCTGGCTACCAGGAAGGAGCTGG - Intergenic
1134618097 16:15667424-15667446 GCTGGAAACCATCAAGGTGAGGG + Exonic
1136990699 16:35149756-35149778 GCTGGATGCCAAGAAGGTGAAGG - Intergenic
1141306008 16:82864899-82864921 CCTGGATACAATGGAGGTACGGG + Intronic
1142237902 16:88931289-88931311 GCTGGAAACCAGGAGGGTGGAGG + Intronic
1142411567 16:89919629-89919651 GCTGGACAGCATGGAGCTGCAGG - Exonic
1142431619 16:90031551-90031573 GCTGGATCCAGTGAGGGTGCAGG + Intronic
1144416373 17:15051083-15051105 GCTGGGTACCAAGAATATGCAGG + Intergenic
1144778491 17:17796499-17796521 GCTGGAGACCTTGAATGTGGCGG - Exonic
1145998560 17:29118126-29118148 GCAGGCGGCCATGAAGGTGCTGG - Exonic
1149029585 17:52067874-52067896 CCTGGATACAATGCAGGTACAGG - Intronic
1149334600 17:55622577-55622599 ACTGGATATCATAAAGGTGATGG - Intergenic
1151930525 17:77229048-77229070 GCTGGACACACAGAAGGTGCTGG + Intergenic
1152720782 17:81922988-81923010 GCTGGTGACCATGTCGGTGCGGG - Exonic
1154388991 18:13920432-13920454 GCCGGGCACCATGCAGGTGCTGG + Intergenic
1155565215 18:27126936-27126958 TCTGGATAACATGTAGGTGCAGG + Intronic
1156858770 18:41813220-41813242 CCTAGATACAATGAGGGTGCAGG + Intergenic
1160463054 18:79054047-79054069 TCAGGATTCCAAGAAGGTGCAGG + Intergenic
1161249976 19:3275377-3275399 GCTGGGCACCGTGAAAGTGCGGG + Intronic
1165116719 19:33533259-33533281 GCTGGAAACCAGGAAGGAGGAGG - Intergenic
1167427802 19:49438420-49438442 GCTGGATCCCAGGAAGGGGCTGG + Intronic
1167791843 19:51688253-51688275 GCAGGAAACCAAGGAGGTGCTGG - Intergenic
925455980 2:4017059-4017081 CCTAGATACAATGAAGGTACAGG + Intergenic
926491731 2:13532859-13532881 GCTGAACACCATGAAGGAGCAGG - Intergenic
928549864 2:32359466-32359488 GATGTATAACATGAAGGTGTAGG + Intronic
929044981 2:37780337-37780359 GCTAGAGACCAGGGAGGTGCAGG + Intergenic
930507830 2:52305909-52305931 CCTAGATACAATGGAGGTGCAGG - Intergenic
930521387 2:52471374-52471396 CCTAGATACAATGAAGGTACAGG - Intergenic
930749975 2:54925280-54925302 GCTGGGCAAGATGAAGGTGCTGG - Intronic
931096198 2:58943452-58943474 CCTAGATACAATGAAGGTACAGG - Intergenic
932252884 2:70259469-70259491 CCTGGCTACCATGATGGTGCAGG + Exonic
933542427 2:83664555-83664577 GCAGGCTACCATCAAAGTGCTGG + Intergenic
938408404 2:131045281-131045303 CCTGGGCACCAGGAAGGTGCAGG + Intronic
938761261 2:134428329-134428351 GCATGATACCATGAAGGAGAAGG - Intronic
941307687 2:163891801-163891823 CCTGGATACAATGCAGGTACAGG + Intergenic
942727609 2:179026969-179026991 CCTAGATACAATGAAGGTACAGG - Intronic
942896721 2:181065265-181065287 GCGGGAAAGCATGAAGGTGCAGG - Intronic
943484046 2:188457051-188457073 CCTAGATACAATGAAGGTACAGG - Intronic
945846979 2:214957329-214957351 GATGGACACAATGAAGGTGGTGG + Intronic
947501511 2:230674564-230674586 GCTGCATCCCAAGCAGGTGCAGG - Intergenic
947619404 2:231579810-231579832 GCTGGACAGCATGATGGTGGTGG - Intergenic
1173036683 20:39418483-39418505 GATGGAGACCATGAATATGCAGG + Intergenic
1173878083 20:46389142-46389164 GCTGGATGCCATGAAGGAGCTGG - Exonic
1178261776 21:31106622-31106644 CCTAGATACAATGAAGGTACAGG + Intergenic
1181029572 22:20143264-20143286 GATGGATGCCATGATGGTCCTGG - Exonic
1181513682 22:23400054-23400076 GATGGATGCCATGATGGTCCTGG + Intergenic
1184632414 22:45793585-45793607 GCTGCCTAAAATGAAGGTGCAGG - Intronic
955840826 3:63110918-63110940 GGTGGATTCCTTGAAGCTGCTGG + Intergenic
959596535 3:108135267-108135289 GGAGGAAACCATGAAGCTGCTGG - Intergenic
963363138 3:144302731-144302753 CCTAGATACAATGAAGGTACAGG + Intergenic
966194157 3:177297260-177297282 GCTGGTGAACATGAATGTGCAGG - Intergenic
966777182 3:183553225-183553247 GCTGGAGAACATGAGGGTGAAGG - Intronic
968095106 3:195923885-195923907 GCTGGACAACGTGAAGGAGCAGG - Intergenic
968471533 4:784756-784778 GCGGGAGACCCTGAAGGCGCAGG + Intergenic
968953672 4:3707478-3707500 CTTGGATGCCATGAAGATGCAGG + Intergenic
969194721 4:5551488-5551510 GCTAGATACAATGGAGGTACAGG - Intronic
970099273 4:12502606-12502628 CCTAGATACAATGAAGGTACAGG + Intergenic
971939873 4:33200481-33200503 CCTAGATACCATGGAGGTACAGG - Intergenic
971962606 4:33508127-33508149 CCTAGATACAATGAGGGTGCAGG - Intergenic
972248935 4:37278666-37278688 GCTGGTTTCTATGAAGGTTCAGG - Intronic
972756852 4:42056799-42056821 CCTGGATACAATGAGGGTACAGG + Intronic
974153783 4:58044156-58044178 CCTAGATACAATGTAGGTGCAGG - Intergenic
978654852 4:111052704-111052726 CCTAGATACAATGAAGGTACAGG - Intergenic
980525615 4:133988367-133988389 CCTGGATACAATGAGGGTACAGG + Intergenic
982984487 4:162188862-162188884 GCTGGGTAAAATGATGGTGCTGG + Intergenic
983775010 4:171595312-171595334 CCTGGATACCTTGCTGGTGCAGG + Intergenic
984132353 4:175893572-175893594 GGAGGACCCCATGAAGGTGCTGG - Intronic
985427072 4:189841404-189841426 GATGGGTACCACTAAGGTGCAGG - Intergenic
985913511 5:2900767-2900789 GCTGGAGAGGATGAAGGTGGAGG - Intergenic
986105425 5:4655409-4655431 CCTAGATACAATGAGGGTGCAGG + Intergenic
987744173 5:21948502-21948524 CCTAGATACCATGAGGGTACAGG - Intronic
988065764 5:26227910-26227932 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
988964734 5:36404480-36404502 GGTGGACACCATTAATGTGCAGG + Intergenic
990415021 5:55578203-55578225 GCTGGATAACAGGAAAGTGGTGG - Intergenic
990487627 5:56274988-56275010 GGTGGGTAACATGAAAGTGCTGG - Intergenic
990762736 5:59148552-59148574 AGTGGTTACCATGCAGGTGCTGG - Intronic
993575237 5:89591691-89591713 CCTGGATACAATGAGGGTACAGG - Intergenic
994109794 5:95988345-95988367 GCAGTATACAATGAAGCTGCCGG + Intergenic
994117043 5:96072366-96072388 GCTGGAGAACATGAATTTGCAGG + Intergenic
995200119 5:109415647-109415669 GCTAGATACAATGGAGGTACAGG - Intergenic
997056580 5:130451609-130451631 GCTGGATACGATGAGGGTACAGG + Intergenic
998384223 5:141747204-141747226 GCTGGATACCATCTAGGAGGTGG + Intergenic
1003003642 6:2360599-2360621 GCTGGACACCATGGCTGTGCAGG + Intergenic
1003505782 6:6739212-6739234 GGAGGTTGCCATGAAGGTGCAGG - Intergenic
1006026555 6:31150718-31150740 TCTGGAAACCATGCAGGTGAGGG - Exonic
1006467852 6:34206747-34206769 GCTGGACATCCTGAAGGGGCGGG + Intergenic
1007111853 6:39317427-39317449 GCTGAACACCCTGAAGGAGCTGG - Intronic
1007426242 6:41748069-41748091 GCTGGTTACAATGATGGTGATGG + Intronic
1009346184 6:62614855-62614877 CCTGGATACAATGGAGGTACAGG - Intergenic
1009957051 6:70468447-70468469 GGTGGATACCATGTATGTGGTGG - Intronic
1010531044 6:76967321-76967343 CCTAGATACAATGAAGGTACAGG - Intergenic
1010909463 6:81536057-81536079 GCTGGATACAATGGGGGTACAGG + Intronic
1011895345 6:92217639-92217661 CCTGGATACAATGAGGGTACAGG - Intergenic
1012126043 6:95428974-95428996 CCTAGATACAATGAAGGTACAGG - Intergenic
1012762392 6:103318338-103318360 CCTGGATACAATGAGGGTACAGG - Intergenic
1013136605 6:107288721-107288743 GCTGGACAATATGAAGATGCCGG + Intronic
1013915942 6:115336848-115336870 CCTGGATACAGTGAAGGTACAGG - Intergenic
1013927650 6:115492871-115492893 CCTAGATACAATGAAGGTACAGG + Intergenic
1013928685 6:115503332-115503354 CCTGGATACAATGGAGGTACAGG - Intergenic
1016643602 6:146378599-146378621 GCTAGATACAATGAGGGTACAGG - Intronic
1017640756 6:156491324-156491346 CCTAGATACAATGAAGGTACAGG - Intergenic
1018530435 6:164757519-164757541 GCTGGCCACCATGGAGGAGCTGG + Intergenic
1018742369 6:166739940-166739962 GTAGGAAACAATGAAGGTGCTGG - Intronic
1019502121 7:1369612-1369634 GCTGGAGACCATGAAGTGGGCGG - Intergenic
1022288326 7:28976538-28976560 GCAGGATACCAAGATGGTCCAGG - Intergenic
1023386280 7:39661446-39661468 CCTGGATACAATGAGGGTGCAGG + Intronic
1024191415 7:47015164-47015186 GCTGGATAGCAGGAAGCTGCCGG + Intergenic
1027150794 7:75732215-75732237 GCTGGGTACCAGGAACATGCTGG - Intronic
1027996849 7:85435162-85435184 CCTAGATACAATGAGGGTGCAGG - Intergenic
1031473241 7:122191940-122191962 CCTGGATACAATGAGGGTACAGG - Intergenic
1031986680 7:128168156-128168178 GCCCGAGACCAGGAAGGTGCGGG - Intergenic
1034037247 7:147837652-147837674 CCTAGATACAATGAGGGTGCAGG + Intronic
1038495678 8:28000413-28000435 GGTGGATTCCATGACGGCGCAGG - Intergenic
1039177953 8:34830466-34830488 GCTTGAAACCATGAATGTCCTGG - Intergenic
1043426197 8:80150760-80150782 CCTAGATACAATGAAGGTACAGG - Intronic
1047410511 8:124620966-124620988 GAGGGATACCAGGAAGGGGCTGG - Intronic
1048116791 8:131532411-131532433 CCTGGATACAATGAGGGTACAGG - Intergenic
1049320271 8:141992508-141992530 GCTGGACACCGTCCAGGTGCTGG - Intergenic
1049340513 8:142109848-142109870 GCAGGATACCAGGAGGGTGGGGG + Intergenic
1049809296 8:144556546-144556568 TCTGAATACTATGAAGGTTCAGG - Intronic
1049809305 8:144556636-144556658 TCTGAATACTATGAAGGTTCAGG - Intronic
1049809338 8:144556974-144556996 TCTGAATACTATGAAGGTTCAGG - Intronic
1049809407 8:144557672-144557694 TCTGAATACTATGAAGGTTCAGG - Intronic
1052798660 9:32947112-32947134 GCTGGTGAGCATGAACGTGCAGG + Intergenic
1053104716 9:35399714-35399736 CCTGGACACCATCAAGGTGGAGG + Exonic
1054949768 9:70836707-70836729 GCTGGAGACCATGAGGATCCCGG + Intronic
1055626192 9:78179392-78179414 GCTGGTGAGCATGAAAGTGCAGG + Intergenic
1056707852 9:88967124-88967146 GGTGGCTCCCAGGAAGGTGCAGG - Intergenic
1057863656 9:98662384-98662406 GCTGGGTACAATCAATGTGCTGG + Intronic
1058649299 9:107159872-107159894 CCTGGATACAATGAGGGTACAGG - Intergenic
1060653482 9:125351536-125351558 CCTAGATACAATGGAGGTGCAGG + Intronic
1060945457 9:127567547-127567569 GCTGGGCACCAGGGAGGTGCTGG - Intronic
1061031606 9:128087656-128087678 GCTGGAGTCCATGAAGGAGGGGG - Intronic
1061232840 9:129324967-129324989 GCTGGACACAAGGAAGGTGCTGG - Intergenic
1061893926 9:133637154-133637176 GCTGGATCCCATGGGTGTGCAGG - Intronic
1062423778 9:136496872-136496894 GCTGGAGCCCAGGACGGTGCTGG + Exonic
1062486371 9:136778489-136778511 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486384 9:136778538-136778560 GCTGGAAACCCTGGAGGAGCCGG - Intergenic
1062486439 9:136778783-136778805 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486450 9:136778832-136778854 GCTGGAGACCCTGGAGGAGCCGG - Intergenic
1062486483 9:136778979-136779001 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486506 9:136779078-136779100 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486524 9:136779176-136779198 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1062486547 9:136779275-136779297 GCTGGAGACCCTGGAGGAGCTGG - Intergenic
1188106023 X:26147977-26147999 CCTGAATACAATGAAGGTGCAGG + Intergenic
1190298817 X:49043992-49044014 GCTACATTCCCTGAAGGTGCGGG + Intergenic
1191892946 X:65963480-65963502 GCTGGATTCCAGGAAGGTATGGG - Intergenic
1192532058 X:71896569-71896591 GCTAGATACCATTTAGGGGCTGG - Intergenic
1192915669 X:75648897-75648919 GCTGAACACCAGGAAGGAGCTGG - Intergenic
1193645313 X:84061082-84061104 GATAGATAGCATGAAGGGGCTGG + Intronic
1195816856 X:108897240-108897262 CCTAGATACAATGAAGGTACAGG - Intergenic
1196434956 X:115666013-115666035 GCTGGTGAGCATGAACGTGCAGG + Intergenic
1196543555 X:116937147-116937169 GCTAGATACAATTGAGGTGCAGG + Intergenic
1198996451 X:142578899-142578921 CCTAGATACAATGGAGGTGCAGG - Intergenic
1201237161 Y:11922631-11922653 GCTGGTGAGCATGAATGTGCAGG - Intergenic