ID: 1123732239

View in Genome Browser
Species Human (GRCh38)
Location 15:23157168-23157190
Sequence CTCCCCTCTCTTAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123732234_1123732239 -6 Left 1123732234 15:23157151-23157173 CCCAGAGTTGGCGGCCTCTCCCC No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732232_1123732239 0 Left 1123732232 15:23157145-23157167 CCCTCTCCCAGAGTTGGCGGCCT No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732229_1123732239 5 Left 1123732229 15:23157140-23157162 CCTGCCCCTCTCCCAGAGTTGGC No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732226_1123732239 10 Left 1123732226 15:23157135-23157157 CCGGCCCTGCCCCTCTCCCAGAG No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732231_1123732239 1 Left 1123732231 15:23157144-23157166 CCCCTCTCCCAGAGTTGGCGGCC No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732233_1123732239 -1 Left 1123732233 15:23157146-23157168 CCTCTCCCAGAGTTGGCGGCCTC No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732227_1123732239 6 Left 1123732227 15:23157139-23157161 CCCTGCCCCTCTCCCAGAGTTGG No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data
1123732235_1123732239 -7 Left 1123732235 15:23157152-23157174 CCAGAGTTGGCGGCCTCTCCCCT No data
Right 1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123732239 Original CRISPR CTCCCCTCTCTTAGAGTGGG TGG Intergenic
No off target data available for this crispr