ID: 1123732350

View in Genome Browser
Species Human (GRCh38)
Location 15:23157696-23157718
Sequence CTGCCCTCACCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123732341_1123732350 14 Left 1123732341 15:23157659-23157681 CCAGTCAGCCCCACCCCTTCAGC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732347_1123732350 -1 Left 1123732347 15:23157674-23157696 CCTTCAGCAAGCAGCCCAGTCTC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732342_1123732350 6 Left 1123732342 15:23157667-23157689 CCCCACCCCTTCAGCAAGCAGCC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732337_1123732350 30 Left 1123732337 15:23157643-23157665 CCCCACCAAAGTTTTGCCAGTCA No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732340_1123732350 25 Left 1123732340 15:23157648-23157670 CCAAAGTTTTGCCAGTCAGCCCC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732346_1123732350 0 Left 1123732346 15:23157673-23157695 CCCTTCAGCAAGCAGCCCAGTCT No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732345_1123732350 1 Left 1123732345 15:23157672-23157694 CCCCTTCAGCAAGCAGCCCAGTC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732339_1123732350 28 Left 1123732339 15:23157645-23157667 CCACCAAAGTTTTGCCAGTCAGC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732343_1123732350 5 Left 1123732343 15:23157668-23157690 CCCACCCCTTCAGCAAGCAGCCC No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732338_1123732350 29 Left 1123732338 15:23157644-23157666 CCCACCAAAGTTTTGCCAGTCAG No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data
1123732344_1123732350 4 Left 1123732344 15:23157669-23157691 CCACCCCTTCAGCAAGCAGCCCA No data
Right 1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123732350 Original CRISPR CTGCCCTCACCAATCACCCC AGG Intergenic
No off target data available for this crispr