ID: 1123732799

View in Genome Browser
Species Human (GRCh38)
Location 15:23160489-23160511
Sequence CAGGCTAGCACTTCCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123732799_1123732802 -9 Left 1123732799 15:23160489-23160511 CCTCTTGGGGAAGTGCTAGCCTG No data
Right 1123732802 15:23160503-23160525 GCTAGCCTGACTGGTTGTCAGGG No data
1123732799_1123732803 -8 Left 1123732799 15:23160489-23160511 CCTCTTGGGGAAGTGCTAGCCTG No data
Right 1123732803 15:23160504-23160526 CTAGCCTGACTGGTTGTCAGGGG No data
1123732799_1123732801 -10 Left 1123732799 15:23160489-23160511 CCTCTTGGGGAAGTGCTAGCCTG No data
Right 1123732801 15:23160502-23160524 TGCTAGCCTGACTGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123732799 Original CRISPR CAGGCTAGCACTTCCCCAAG AGG (reversed) Intergenic
No off target data available for this crispr