ID: 1123733923

View in Genome Browser
Species Human (GRCh38)
Location 15:23166908-23166930
Sequence CTCGCCAGCGACCTGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733923_1123733931 25 Left 1123733923 15:23166908-23166930 CCTGAGGGCAGGTCGCTGGCGAG No data
Right 1123733931 15:23166956-23166978 GAGCGGCTTTATGGACCACCTGG No data
1123733923_1123733932 28 Left 1123733923 15:23166908-23166930 CCTGAGGGCAGGTCGCTGGCGAG No data
Right 1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG No data
1123733923_1123733929 16 Left 1123733923 15:23166908-23166930 CCTGAGGGCAGGTCGCTGGCGAG No data
Right 1123733929 15:23166947-23166969 TTGGCTCCAGAGCGGCTTTATGG No data
1123733923_1123733924 -3 Left 1123733923 15:23166908-23166930 CCTGAGGGCAGGTCGCTGGCGAG No data
Right 1123733924 15:23166928-23166950 GAGATGTGACCCCATTATTTTGG No data
1123733923_1123733928 8 Left 1123733923 15:23166908-23166930 CCTGAGGGCAGGTCGCTGGCGAG No data
Right 1123733928 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733923 Original CRISPR CTCGCCAGCGACCTGCCCTC AGG (reversed) Intergenic
No off target data available for this crispr