ID: 1123733925

View in Genome Browser
Species Human (GRCh38)
Location 15:23166937-23166959
Sequence GCTCTGGAGCCAAAATAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733925_1123733937 26 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733925_1123733936 23 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data
1123733925_1123733933 5 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733933 15:23166965-23166987 TATGGACCACCTGGAGGAGAAGG No data
1123733925_1123733932 -1 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG No data
1123733925_1123733931 -4 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733931 15:23166956-23166978 GAGCGGCTTTATGGACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733925 Original CRISPR GCTCTGGAGCCAAAATAATG GGG (reversed) Intergenic