ID: 1123733927

View in Genome Browser
Species Human (GRCh38)
Location 15:23166939-23166961
Sequence CCGCTCTGGAGCCAAAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733927_1123733937 24 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733927_1123733936 21 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data
1123733927_1123733933 3 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733933 15:23166965-23166987 TATGGACCACCTGGAGGAGAAGG No data
1123733927_1123733931 -6 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733931 15:23166956-23166978 GAGCGGCTTTATGGACCACCTGG No data
1123733927_1123733932 -3 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733927 Original CRISPR CCGCTCTGGAGCCAAAATAA TGG (reversed) Intergenic
No off target data available for this crispr