ID: 1123733930

View in Genome Browser
Species Human (GRCh38)
Location 15:23166953-23166975
Sequence GGTGGTCCATAAAGCCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733930_1123733939 26 Left 1123733930 15:23166953-23166975 CCAGAGCGGCTTTATGGACCACC No data
Right 1123733939 15:23167002-23167024 CTGGTGGAGAAAGAAGAACTTGG No data
1123733930_1123733937 10 Left 1123733930 15:23166953-23166975 CCAGAGCGGCTTTATGGACCACC No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733930_1123733936 7 Left 1123733930 15:23166953-23166975 CCAGAGCGGCTTTATGGACCACC No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733930 Original CRISPR GGTGGTCCATAAAGCCGCTC TGG (reversed) Intergenic
No off target data available for this crispr