ID: 1123733936

View in Genome Browser
Species Human (GRCh38)
Location 15:23166983-23167005
Sequence GAAGGCAGACCTGAGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733927_1123733936 21 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data
1123733925_1123733936 23 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data
1123733930_1123733936 7 Left 1123733930 15:23166953-23166975 CCAGAGCGGCTTTATGGACCACC No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data
1123733926_1123733936 22 Left 1123733926 15:23166938-23166960 CCCATTATTTTGGCTCCAGAGCG No data
Right 1123733936 15:23166983-23167005 GAAGGCAGACCTGAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733936 Original CRISPR GAAGGCAGACCTGAGTGAGC TGG Intergenic
No off target data available for this crispr