ID: 1123733937

View in Genome Browser
Species Human (GRCh38)
Location 15:23166986-23167008
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733930_1123733937 10 Left 1123733930 15:23166953-23166975 CCAGAGCGGCTTTATGGACCACC No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733925_1123733937 26 Left 1123733925 15:23166937-23166959 CCCCATTATTTTGGCTCCAGAGC No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733934_1123733937 -8 Left 1123733934 15:23166971-23166993 CCACCTGGAGGAGAAGGCAGACC No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733927_1123733937 24 Left 1123733927 15:23166939-23166961 CCATTATTTTGGCTCCAGAGCGG No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data
1123733926_1123733937 25 Left 1123733926 15:23166938-23166960 CCCATTATTTTGGCTCCAGAGCG No data
Right 1123733937 15:23166986-23167008 GGCAGACCTGAGTGAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733937 Original CRISPR GGCAGACCTGAGTGAGCTGG TGG Intergenic
No off target data available for this crispr