ID: 1123733939

View in Genome Browser
Species Human (GRCh38)
Location 15:23167002-23167024
Sequence CTGGTGGAGAAAGAAGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123733935_1123733939 5 Left 1123733935 15:23166974-23166996 CCTGGAGGAGAAGGCAGACCTGA No data
Right 1123733939 15:23167002-23167024 CTGGTGGAGAAAGAAGAACTTGG No data
1123733934_1123733939 8 Left 1123733934 15:23166971-23166993 CCACCTGGAGGAGAAGGCAGACC No data
Right 1123733939 15:23167002-23167024 CTGGTGGAGAAAGAAGAACTTGG No data
1123733930_1123733939 26 Left 1123733930 15:23166953-23166975 CCAGAGCGGCTTTATGGACCACC No data
Right 1123733939 15:23167002-23167024 CTGGTGGAGAAAGAAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123733939 Original CRISPR CTGGTGGAGAAAGAAGAACT TGG Intergenic
No off target data available for this crispr