ID: 1123736720

View in Genome Browser
Species Human (GRCh38)
Location 15:23191677-23191699
Sequence CTGCTGTCCCAGTGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123736716_1123736720 -10 Left 1123736716 15:23191664-23191686 CCCTTCAGTTCTACTGCTGTCCC No data
Right 1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG No data
1123736715_1123736720 17 Left 1123736715 15:23191637-23191659 CCTGCTGAGGTAGCTGTTGTCTG No data
Right 1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123736720 Original CRISPR CTGCTGTCCCAGTGGAAAAA GGG Intergenic
No off target data available for this crispr