ID: 1123742481

View in Genome Browser
Species Human (GRCh38)
Location 15:23293072-23293094
Sequence TCCTGGAGCAGGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123742476_1123742481 -7 Left 1123742476 15:23293056-23293078 CCAAAAGACTGGACCCTCCTGGA No data
Right 1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG No data
1123742471_1123742481 12 Left 1123742471 15:23293037-23293059 CCAGTGTGGCCCAGGGAAACCAA 0: 23
1: 354
2: 884
3: 838
4: 683
Right 1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG No data
1123742467_1123742481 29 Left 1123742467 15:23293020-23293042 CCAAGACAATTCTTCTTCCAGTG 0: 141
1: 382
2: 397
3: 233
4: 394
Right 1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG No data
1123742474_1123742481 2 Left 1123742474 15:23293047-23293069 CCAGGGAAACCAAAAGACTGGAC 0: 10
1: 116
2: 894
3: 994
4: 751
Right 1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG No data
1123742473_1123742481 3 Left 1123742473 15:23293046-23293068 CCCAGGGAAACCAAAAGACTGGA 0: 8
1: 132
2: 905
3: 1022
4: 794
Right 1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG No data
1123742466_1123742481 30 Left 1123742466 15:23293019-23293041 CCCAAGACAATTCTTCTTCCAGT 0: 130
1: 394
2: 410
3: 264
4: 747
Right 1123742481 15:23293072-23293094 TCCTGGAGCAGGGTTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123742481 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG Intergenic
No off target data available for this crispr