ID: 1123746072

View in Genome Browser
Species Human (GRCh38)
Location 15:23320941-23320963
Sequence GGAAATGGTGCTGTCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746072_1123746079 5 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746079 15:23320969-23320991 CAGCGGGGCAGTTTCCTTACAGG No data
1123746072_1123746083 30 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746083 15:23320994-23321016 AGTTAATGAGGCACTAACGAAGG No data
1123746072_1123746081 18 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data
1123746072_1123746080 6 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746080 15:23320970-23320992 AGCGGGGCAGTTTCCTTACAGGG No data
1123746072_1123746075 -10 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746075 15:23320954-23320976 CACCATTTCCAGCCTCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746072 Original CRISPR GGAAATGGTGCTGTCCAGAG TGG (reversed) Intergenic