ID: 1123746076

View in Genome Browser
Species Human (GRCh38)
Location 15:23320956-23320978
Sequence TGCCCCGCTGAGGCTGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746076_1123746086 23 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746086 15:23321002-23321024 AGGCACTAACGAAGGCTCAGGGG No data
1123746076_1123746089 30 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data
1123746076_1123746084 21 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746084 15:23321000-23321022 TGAGGCACTAACGAAGGCTCAGG No data
1123746076_1123746088 29 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746088 15:23321008-23321030 TAACGAAGGCTCAGGGGACAGGG No data
1123746076_1123746079 -10 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746079 15:23320969-23320991 CAGCGGGGCAGTTTCCTTACAGG No data
1123746076_1123746080 -9 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746080 15:23320970-23320992 AGCGGGGCAGTTTCCTTACAGGG No data
1123746076_1123746083 15 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746083 15:23320994-23321016 AGTTAATGAGGCACTAACGAAGG No data
1123746076_1123746085 22 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746085 15:23321001-23321023 GAGGCACTAACGAAGGCTCAGGG No data
1123746076_1123746087 28 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746087 15:23321007-23321029 CTAACGAAGGCTCAGGGGACAGG No data
1123746076_1123746081 3 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746076 Original CRISPR TGCCCCGCTGAGGCTGGAAA TGG (reversed) Intergenic