ID: 1123746077

View in Genome Browser
Species Human (GRCh38)
Location 15:23320962-23320984
Sequence GGAAACTGCCCCGCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746077_1123746085 16 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746085 15:23321001-23321023 GAGGCACTAACGAAGGCTCAGGG No data
1123746077_1123746090 25 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746090 15:23321010-23321032 ACGAAGGCTCAGGGGACAGGGGG No data
1123746077_1123746086 17 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746086 15:23321002-23321024 AGGCACTAACGAAGGCTCAGGGG No data
1123746077_1123746084 15 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746084 15:23321000-23321022 TGAGGCACTAACGAAGGCTCAGG No data
1123746077_1123746088 23 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746088 15:23321008-23321030 TAACGAAGGCTCAGGGGACAGGG No data
1123746077_1123746087 22 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746087 15:23321007-23321029 CTAACGAAGGCTCAGGGGACAGG No data
1123746077_1123746081 -3 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746081 15:23320982-23321004 TCCTTACAGGGAAGTTAATGAGG No data
1123746077_1123746083 9 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746083 15:23320994-23321016 AGTTAATGAGGCACTAACGAAGG No data
1123746077_1123746089 24 Left 1123746077 15:23320962-23320984 CCAGCCTCAGCGGGGCAGTTTCC No data
Right 1123746089 15:23321009-23321031 AACGAAGGCTCAGGGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746077 Original CRISPR GGAAACTGCCCCGCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr