ID: 1123746079

View in Genome Browser
Species Human (GRCh38)
Location 15:23320969-23320991
Sequence CAGCGGGGCAGTTTCCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123746072_1123746079 5 Left 1123746072 15:23320941-23320963 CCACTCTGGACAGCACCATTTCC No data
Right 1123746079 15:23320969-23320991 CAGCGGGGCAGTTTCCTTACAGG No data
1123746076_1123746079 -10 Left 1123746076 15:23320956-23320978 CCATTTCCAGCCTCAGCGGGGCA No data
Right 1123746079 15:23320969-23320991 CAGCGGGGCAGTTTCCTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123746079 Original CRISPR CAGCGGGGCAGTTTCCTTAC AGG Intergenic